ID: 1028579595

View in Genome Browser
Species Human (GRCh38)
Location 7:92394142-92394164
Sequence TCTCATCTTTACAATGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028579593_1028579595 1 Left 1028579593 7:92394118-92394140 CCTAGGCTATGTTCTTTCTTAAT 0: 1
1: 0
2: 0
3: 25
4: 450
Right 1028579595 7:92394142-92394164 TCTCATCTTTACAATGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028579595 Original CRISPR TCTCATCTTTACAATGTGGA TGG Intronic
No off target data available for this crispr