ID: 1028580386

View in Genome Browser
Species Human (GRCh38)
Location 7:92403728-92403750
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028580381_1028580386 29 Left 1028580381 7:92403676-92403698 CCTGCAGGCAGGCAGAGGAAGGG No data
Right 1028580386 7:92403728-92403750 CTGTTACAATGTAAAATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028580386 Original CRISPR CTGTTACAATGTAAAATAAA TGG Intergenic
No off target data available for this crispr