ID: 1028582682

View in Genome Browser
Species Human (GRCh38)
Location 7:92423539-92423561
Sequence AGTCATCTGGAGAGGAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028582682_1028582687 0 Left 1028582682 7:92423539-92423561 CCAGCCTTCCTCTCCAGATGACT No data
Right 1028582687 7:92423562-92423584 TTCTTCCTCTTATACTGGATCGG No data
1028582682_1028582686 -5 Left 1028582682 7:92423539-92423561 CCAGCCTTCCTCTCCAGATGACT No data
Right 1028582686 7:92423557-92423579 TGACTTTCTTCCTCTTATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028582682 Original CRISPR AGTCATCTGGAGAGGAAGGC TGG (reversed) Intergenic
No off target data available for this crispr