ID: 1028583947

View in Genome Browser
Species Human (GRCh38)
Location 7:92434776-92434798
Sequence GCTTTTCCTCTACAGCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028583942_1028583947 24 Left 1028583942 7:92434729-92434751 CCAAGGAACGCAGGTGGCCTCTA No data
Right 1028583947 7:92434776-92434798 GCTTTTCCTCTACAGCCTCCAGG No data
1028583945_1028583947 7 Left 1028583945 7:92434746-92434768 CCTCTAGAAGTTGGAAAAGGCAA No data
Right 1028583947 7:92434776-92434798 GCTTTTCCTCTACAGCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028583947 Original CRISPR GCTTTTCCTCTACAGCCTCC AGG Intergenic
No off target data available for this crispr