ID: 1028585723

View in Genome Browser
Species Human (GRCh38)
Location 7:92449019-92449041
Sequence AAGGGAATGAGCTCTGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 172}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028585716_1028585723 12 Left 1028585716 7:92448984-92449006 CCTTAGTATTCTGGGGAATGGTC 0: 1
1: 0
2: 1
3: 6
4: 93
Right 1028585723 7:92449019-92449041 AAGGGAATGAGCTCTGTTGCAGG 0: 1
1: 0
2: 1
3: 18
4: 172
1028585719_1028585723 -10 Left 1028585719 7:92449006-92449028 CCAGATTCCCCAAAAGGGAATGA 0: 1
1: 0
2: 1
3: 22
4: 191
Right 1028585723 7:92449019-92449041 AAGGGAATGAGCTCTGTTGCAGG 0: 1
1: 0
2: 1
3: 18
4: 172
1028585713_1028585723 17 Left 1028585713 7:92448979-92449001 CCCTTCCTTAGTATTCTGGGGAA 0: 1
1: 0
2: 0
3: 16
4: 185
Right 1028585723 7:92449019-92449041 AAGGGAATGAGCTCTGTTGCAGG 0: 1
1: 0
2: 1
3: 18
4: 172
1028585714_1028585723 16 Left 1028585714 7:92448980-92449002 CCTTCCTTAGTATTCTGGGGAAT 0: 1
1: 0
2: 0
3: 17
4: 138
Right 1028585723 7:92449019-92449041 AAGGGAATGAGCTCTGTTGCAGG 0: 1
1: 0
2: 1
3: 18
4: 172
1028585708_1028585723 27 Left 1028585708 7:92448969-92448991 CCCTTGGTAGCCCTTCCTTAGTA 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1028585723 7:92449019-92449041 AAGGGAATGAGCTCTGTTGCAGG 0: 1
1: 0
2: 1
3: 18
4: 172
1028585709_1028585723 26 Left 1028585709 7:92448970-92448992 CCTTGGTAGCCCTTCCTTAGTAT 0: 1
1: 0
2: 1
3: 2
4: 108
Right 1028585723 7:92449019-92449041 AAGGGAATGAGCTCTGTTGCAGG 0: 1
1: 0
2: 1
3: 18
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028585723 Original CRISPR AAGGGAATGAGCTCTGTTGC AGG Intronic
901143048 1:7047867-7047889 AAGTCACAGAGCTCTGTTGCTGG - Intronic
901220658 1:7581769-7581791 AATGGAAGGAGCACTGTTTCTGG + Intronic
901926482 1:12569358-12569380 AAAAAAATGAGCTCTGTTTCAGG - Intronic
902674709 1:18000656-18000678 AAGGGAATGAGTTCCGTTGGTGG + Intergenic
904321263 1:29698953-29698975 AAGGGCATGTGCTCTGTTATAGG + Intergenic
905194690 1:36266581-36266603 AAGGAAATGTGATCTCTTGCTGG + Intronic
905948010 1:41919995-41920017 GAGGGAATGGGCTGTGATGCTGG - Intronic
906196346 1:43932858-43932880 AAGAGGATGAGGTCTGATGCAGG - Intergenic
908870105 1:68600435-68600457 AAGAGTCTGAGCTCTCTTGCAGG - Intergenic
909367753 1:74847766-74847788 AAAGGAATGCTCTCTATTGCTGG + Intergenic
912096199 1:106147969-106147991 AATGGAATTAGCTCTGTAACTGG + Intergenic
916248720 1:162714636-162714658 AAGGGAATGAGAGCTGTTCTAGG - Intronic
916944418 1:169711580-169711602 AAGGGAGTGTGCTGTGCTGCAGG + Exonic
919929202 1:202210189-202210211 AAGGGAATGAGCCTTGCGGCAGG - Intronic
920502724 1:206495564-206495586 AAGAGGATGAGTTCTCTTGCTGG - Intronic
921492887 1:215800311-215800333 AAGGGAAGAAGGTCTGTTGAAGG - Intronic
921571610 1:216786236-216786258 AAGGGAAGGAAGTCTATTGCAGG - Intronic
922314563 1:224432256-224432278 AAGGGAATGATTTTTGATGCTGG - Intronic
922492208 1:226026954-226026976 AAGGCAGTGAGCTTTGTTACTGG - Intergenic
922939943 1:229454256-229454278 CAGGGAATGTGCTGAGTTGCAGG + Intronic
923482968 1:234401980-234402002 AGGGGAATGGGATCTGTTGCGGG - Intronic
923510226 1:234645019-234645041 AAGGGAAGGAGCTTTATGGCAGG + Intergenic
1063477637 10:6342979-6343001 TGGGGAAAGAGCTCTGCTGCAGG + Intergenic
1063649270 10:7917406-7917428 GAGGGAGTGAGCTTTGTGGCAGG + Intronic
1064297599 10:14092435-14092457 CTGGGAATGGACTCTGTTGCTGG + Intronic
1065806900 10:29401885-29401907 AAGGGCATGAGATCTGTGTCTGG - Intergenic
1070393620 10:75992603-75992625 AAGAAAATGAGCCCTGATGCTGG + Intronic
1076043543 10:127272484-127272506 AAGGGAAGGAGTTCTTTTGCTGG + Intronic
1076933700 10:133553094-133553116 AATGGGCTGAGCTCTTTTGCTGG + Intronic
1077538580 11:3135899-3135921 AAGGGAGTGAGCTCTGACTCTGG + Intronic
1077829131 11:5845027-5845049 AAGGAAATGAGGTTTGATGCGGG - Intronic
1080578334 11:33620654-33620676 AAGGGGAGGGGCTCTGTGGCTGG - Intronic
1081417355 11:42831892-42831914 AAGGGAAAGAGCTCTCTGGCAGG + Intergenic
1083258913 11:61512763-61512785 ATGGGAATGGGCTCTGTCCCTGG + Intergenic
1085696263 11:78707314-78707336 AAGGGTATGTCCTTTGTTGCTGG - Intronic
1086370236 11:86149091-86149113 ATGGGATTTTGCTCTGTTGCAGG + Intergenic
1087539096 11:99491999-99492021 AAGGAATTGTGCTCTGTTGAAGG + Intronic
1088597226 11:111449566-111449588 AATGGAATGAGCCCAGTGGCTGG - Intronic
1088660498 11:112041114-112041136 AAGAGTGTGAGCTCTGTAGCTGG + Intronic
1094309607 12:29065060-29065082 AAAGGAATGAGCTGAGGTGCTGG - Intergenic
1096156890 12:49346007-49346029 AAGGGTCTGAGCTGTGGTGCGGG - Intergenic
1097288062 12:57892810-57892832 GAGGCACTGAGCTGTGTTGCAGG - Intergenic
1097504328 12:60445705-60445727 AAGGGAATGGGTGCTGTTGATGG - Intergenic
1097577105 12:61408610-61408632 AAGGCAATGTACTGTGTTGCTGG + Intergenic
1098136751 12:67411016-67411038 GCTGGCATGAGCTCTGTTGCTGG + Intergenic
1104937026 12:132370891-132370913 AAGGGAATCCGCCCTGTTGGTGG - Intergenic
1109748624 13:66660221-66660243 AAGTGAATGAGAGCTGTTGCTGG - Intronic
1113775473 13:112942706-112942728 AAGTGAATGAGTTCAGATGCAGG + Intronic
1115137104 14:30123434-30123456 AAGGGAAGGATCTCTGTTCCTGG + Intronic
1115423945 14:33232299-33232321 AAGGAAACAAGCTCTGTTGTGGG - Intronic
1118035068 14:61857703-61857725 AAGGGAAAAATCTCTGATGCAGG + Intergenic
1118351450 14:64974923-64974945 AAGGGAATGAGGTTTGCTGAAGG + Intronic
1118444685 14:65840509-65840531 AAGGGTGTGAGCTTTGGTGCTGG - Intergenic
1119332087 14:73802520-73802542 TAGGGTATGAGCCCTGTTTCCGG + Intergenic
1120656170 14:87192507-87192529 AAAAAAAAGAGCTCTGTTGCAGG + Intergenic
1120774851 14:88422318-88422340 AAAGGAAGCAGCTCTATTGCTGG - Intronic
1121996790 14:98608858-98608880 AGGGCACTGAGCTCTGTTGTAGG + Intergenic
1122168622 14:99851961-99851983 CAGGGACAGAGCTCTGTAGCAGG - Intronic
1122263121 14:100534438-100534460 AAGGGGCTGAGCTCTGGAGCTGG - Intergenic
1123645022 15:22431798-22431820 GAGGGAAAGAGGTCTGTTCCAGG - Intergenic
1126284057 15:46991079-46991101 AAAGGAATGAGGTCATTTGCAGG - Intergenic
1128935585 15:71743526-71743548 AATGGAAGGAGATCTGTAGCTGG + Intronic
1129868582 15:78926666-78926688 AAGGCAATGAGCCCTGGTTCTGG + Intronic
1130771571 15:86929428-86929450 AGGGGAATGTGATCAGTTGCTGG - Intronic
1132882471 16:2168529-2168551 TAGGGAATGAGCGGGGTTGCTGG + Intronic
1134174961 16:11998241-11998263 AAGTGAATGTGCTCTGTGTCTGG + Intronic
1135064248 16:19296034-19296056 AAAGGAAGGAGCTCTGCTGGGGG - Intronic
1135436128 16:22427877-22427899 AAGGGTATCTGCTGTGTTGCTGG - Intronic
1135543945 16:23353493-23353515 TAGGGAAAGAGCTCTTTTTCTGG - Intronic
1140982920 16:80127804-80127826 AAAGCAATGGGCACTGTTGCTGG + Intergenic
1142045341 16:87921708-87921730 AAGGGCATCTGCTGTGTTGCTGG - Intronic
1143273854 17:5695524-5695546 AAGTTTATGAGCCCTGTTGCTGG - Intergenic
1145978061 17:28995797-28995819 AAGGCAATGAGCTCTAATGGTGG + Intronic
1149641939 17:58208463-58208485 AAGGGAATGAGATCTGCTCCTGG - Intronic
1150491429 17:65577020-65577042 AAGGAGCTGAGCTGTGTTGCTGG - Intronic
1152563926 17:81091808-81091830 AAGGGAAAGGCCTCTGTGGCAGG - Intronic
1153061537 18:999966-999988 AAAGGAATGAGTAATGTTGCTGG - Intergenic
1153160416 18:2198444-2198466 AAGGGAACAAGCTGTTTTGCAGG + Intergenic
1153248205 18:3094483-3094505 GAGGGACTCAGCTCTGATGCTGG + Intronic
1153621407 18:6981768-6981790 AAGGGTATGAGCTGTGTGCCTGG + Intronic
1153772357 18:8426087-8426109 CAGGGGATGAGCTCAGCTGCTGG - Intergenic
1156009808 18:32483704-32483726 AAGGGGAAGAACTGTGTTGCTGG + Intergenic
1157698718 18:49745694-49745716 AAGGGAATGTGCTCTGGGTCAGG - Intergenic
1158556854 18:58482589-58482611 AGGGGAGTGAGCTCTGCTGTAGG - Intronic
1159251396 18:65881843-65881865 AAGCAATTGAGCCCTGTTGCAGG + Exonic
1165314346 19:35045602-35045624 AAGGGAAATAGCCCTGCTGCTGG + Intronic
926158375 2:10470736-10470758 AAGGGAAGGAGCTTTGCTGGTGG + Intergenic
926978114 2:18535134-18535156 AAGGGGAAGAGATGTGTTGCAGG - Intergenic
928123542 2:28601027-28601049 AATGGAGAGAGCTTTGTTGCTGG + Intronic
930765770 2:55083923-55083945 AAGGAATTAAGCTCTGTTTCAGG - Intronic
932273073 2:70428011-70428033 AAGGGAAAGACTGCTGTTGCAGG + Intergenic
932777668 2:74537870-74537892 AAGAAAATGAGGTCTGGTGCTGG + Intronic
933569625 2:83994225-83994247 AAGGGGATGATCTCAGTTTCTGG - Intergenic
937077920 2:119120593-119120615 AAGGGAAAGTGATCTATTGCAGG - Intergenic
945428305 2:209735082-209735104 AGGAGAAAGAGCTCCGTTGCAGG + Intergenic
945672770 2:212821939-212821961 AAGGGAATGTTCTCTGTTGGGGG + Intergenic
945799541 2:214410328-214410350 AAGGGAATGCCCTCTGCAGCGGG - Exonic
946523294 2:220489982-220490004 AAGGGACTGGGATCTGTTTCAGG + Intergenic
948263547 2:236621729-236621751 AAGGGACTCACCTCTGTAGCTGG + Intergenic
948758538 2:240174305-240174327 AAGGTGATAAGCTCTGTTTCAGG + Intergenic
1168790887 20:574895-574917 AAGGGAGTGAGCTCCCTGGCCGG + Intergenic
1171048908 20:21837590-21837612 AAGGGACTGCTCTGTGTTGCAGG - Intergenic
1174195323 20:48768929-48768951 AAGGGAATAGTTTCTGTTGCAGG - Intronic
1174597238 20:51693800-51693822 CAGGGAGTGAGCTCTCCTGCGGG - Intronic
1174969859 20:55262903-55262925 AAGGCAGTGTTCTCTGTTGCTGG - Intergenic
1175021379 20:55853777-55853799 AAGGGAATGAGCTGAATTTCAGG + Intergenic
1175623792 20:60473613-60473635 AAGGGAATAAGATATGTTGCAGG - Intergenic
1177383010 21:20370098-20370120 AAAGGAAATAGCTCTGTTGTGGG - Intergenic
1182731839 22:32502326-32502348 CAGGCAATGAGCTCTGCTCCAGG + Intergenic
1184177730 22:42799082-42799104 CAGGGAGTGAGATCGGTTGCTGG - Exonic
1184244234 22:43227808-43227830 CAGGGAATGAGCACTGCTCCAGG + Intronic
1184553473 22:45218656-45218678 AAGGATATGGGCTCTGTTGGAGG - Intronic
949783393 3:7714766-7714788 AAGGAAATGGACTCTGTTACAGG - Intronic
952817187 3:37455904-37455926 ATGTGAATGTGCTCTGTTGGTGG + Intronic
953635864 3:44663636-44663658 CAGGCTAAGAGCTCTGTTGCAGG + Intergenic
958693193 3:97494631-97494653 AAGGGAATGGGCTATCTTGGAGG - Intronic
960424811 3:117493369-117493391 AAGGCAATGATCTCTGGTGGTGG - Intergenic
960465763 3:117995389-117995411 AAGGGATTAACCTCTGCTGCTGG + Intergenic
961980690 3:131074886-131074908 ATGGGACTGAGCTCTCTTGGAGG + Intronic
962041025 3:131707613-131707635 AAGGGAATGAACTCTGGAACTGG - Intronic
962436560 3:135372341-135372363 AAGTGAATGAGCTCTGTTACAGG - Intergenic
966984879 3:185170543-185170565 AAAGTAATGAGCTCAGTTGCAGG + Intergenic
967304352 3:188046141-188046163 AAGGAAATGGGCTTTGTTCCTGG + Intergenic
967534983 3:190591906-190591928 AAGGGAATGATTTTTTTTGCAGG - Intronic
968544852 4:1193546-1193568 ACGGGAGTGACCCCTGTTGCTGG - Intronic
969262833 4:6044393-6044415 TAGGGAAGGAGTTCTGTGGCAGG - Intronic
969978126 4:11125798-11125820 AAAGGAATGTGTTTTGTTGCTGG - Intergenic
970503164 4:16699363-16699385 CAGGGAATGAAGTCTGTAGCAGG - Intronic
970829796 4:20323612-20323634 AAGGGAAGTAGCACTGTGGCTGG - Intronic
971589798 4:28452992-28453014 AAGTGAAAGAGCTCTATTCCAGG + Intergenic
972820144 4:42692160-42692182 AAGTGAATGAGCTCTGTGATCGG - Intergenic
974973656 4:68862696-68862718 AAGGGAATAAGATCTGTTTTTGG + Intergenic
977127776 4:93192200-93192222 AATGGAATGATTTCAGTTGCTGG - Intronic
980850060 4:138370605-138370627 AAGGGAGTGAGATATTTTGCTGG - Intergenic
981718840 4:147778815-147778837 CAGGGAATGAATTCTGTTGGAGG + Intronic
982468305 4:155758609-155758631 AAAGGAATATCCTCTGTTGCTGG - Intergenic
982482574 4:155930140-155930162 TGGGGAATGAGTTCTGTAGCTGG + Intronic
985493020 5:190164-190186 AAGGGACTGTGCTCCGTTGTGGG - Intergenic
988821125 5:34886914-34886936 AAGGGAATGAGCTCTCTGGAAGG - Intronic
988822299 5:34899289-34899311 AAGGCAATGAGATCTGCTGCTGG + Intronic
990751409 5:59020778-59020800 AAGGGAATGAGTCATTTTGCAGG - Intronic
992421270 5:76607723-76607745 GGGGGACTGAGCTCTGTAGCGGG - Intronic
992916735 5:81462416-81462438 AAGGGAATGAGTCCTGTCCCTGG + Intronic
993069639 5:83144218-83144240 AAGGAAATGATGTCTTTTGCAGG - Intronic
996299916 5:121969120-121969142 TAGAGAATGAGCTCTATTTCTGG - Intronic
996314791 5:122149520-122149542 AAGGGAAGAAGCTCTGCTGGAGG + Intronic
996754584 5:126922211-126922233 TAGGGAAAAAGCTCTGTTGTTGG + Intronic
1001767459 5:174262129-174262151 AAGGGAATCCACTGTGTTGCAGG - Intergenic
1004308040 6:14518942-14518964 AAGGGAATCAGCTCCTTTGCTGG - Intergenic
1008477693 6:51949786-51949808 AAGGGAATGGACTCTCTGGCTGG + Intronic
1008952392 6:57175112-57175134 AAGGGAATCACCTCTGTAGAAGG - Intronic
1009814196 6:68710097-68710119 AAGAGCATGAGCTCTGGAGCTGG - Intronic
1010809619 6:80285791-80285813 AAGGGAATGAGGTTTGATGTAGG + Intronic
1013993602 6:116281184-116281206 AAGGGAAATCGCTATGTTGCTGG + Intronic
1014822024 6:126000583-126000605 AAGGGCATGAGCTCTGGAGTTGG - Intronic
1015281760 6:131442120-131442142 AAGGGAATGAGGTGTGTTTTTGG - Intergenic
1015895135 6:138009782-138009804 ACAGGAAGGATCTCTGTTGCCGG + Intergenic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1021406358 7:20271787-20271809 AAGGAAATGATCTCTATTGGCGG + Intergenic
1026667849 7:72359135-72359157 AAGGGTATGAGATCTAGTGCAGG - Intronic
1028362553 7:89986577-89986599 AAGGAAATGAACTCTGTTGAAGG + Intergenic
1028585723 7:92449019-92449041 AAGGGAATGAGCTCTGTTGCAGG + Intronic
1028681180 7:93534370-93534392 AAATGAATGAGCTCTGGAGCAGG - Intronic
1029218330 7:98968718-98968740 AAGGGAGTGAGTTGTGGTGCTGG + Intronic
1029614662 7:101648723-101648745 AAAGGAATGAGGTCTGTTGAGGG - Intergenic
1034568432 7:151934513-151934535 AAAGGAAAGAGCTCTGCTGACGG - Intergenic
1034862924 7:154615623-154615645 AAGGCATTGGGATCTGTTGCGGG - Intronic
1035790381 8:2298588-2298610 AAGGAACTGAGCACTGTTCCTGG - Intergenic
1035802424 8:2423117-2423139 AAGGAACTGAGCACTGTTCCTGG + Intergenic
1036440013 8:8773636-8773658 AAGGGCAGGAGCTCTGCAGCAGG - Intergenic
1037087899 8:14875707-14875729 AAGTGAATGAGCTGTGATACGGG + Intronic
1037220119 8:16508886-16508908 AATGGAAAGAGCTCAGTAGCTGG - Intronic
1037366608 8:18128985-18129007 AAGGGAATCTGCTGTCTTGCTGG + Intergenic
1037419887 8:18690797-18690819 AAGGGAAGGGGCTCTGAAGCTGG - Intronic
1037448616 8:18994010-18994032 AAGGGAGTGAGCTCTGGAACCGG + Intronic
1038149123 8:24927063-24927085 AAGGGAATGAACTCAGTGGGTGG - Intergenic
1038401795 8:27289354-27289376 AAGGGAACAAGTCCTGTTGCTGG - Intronic
1038697216 8:29817347-29817369 AAGGGCAAGAGCTCTCTTTCAGG - Intergenic
1040589583 8:48778164-48778186 AATGTAATCAGCTCTCTTGCTGG + Intergenic
1045055010 8:98361364-98361386 AAGGGCATAGGCTCTGGTGCTGG + Intergenic
1050675361 9:8046201-8046223 AAAAGAACGAGATCTGTTGCAGG - Intergenic
1055549296 9:77415797-77415819 AAGTGAATGATCTCTTTTGCAGG + Intronic
1056262614 9:84863914-84863936 AAGGGAATGAGCTCTTGTTTGGG - Intronic
1060438148 9:123613941-123613963 AAGGAAAAGGGCTCTGTTGCTGG + Intronic
1061530843 9:131211517-131211539 AAGTGAATGCCATCTGTTGCGGG + Intronic
1062282124 9:135756837-135756859 AAGGGAAGGAGCTCTGGAGCAGG - Intronic
1188170523 X:26918592-26918614 AAGGTCATGAGCTCTGTGACAGG + Intergenic
1189782500 X:44529733-44529755 AAGAGAATGATCTTTGATGCTGG + Intronic
1193238209 X:79134458-79134480 AAGGGACTTGGCTCTGTAGCTGG + Intergenic
1193373605 X:80730563-80730585 AAGGGTATGAGCTTTCTTTCAGG + Intronic
1196718552 X:118832575-118832597 CTGAGAATGAGCTCTGTTCCAGG - Intergenic
1199510840 X:148620275-148620297 AAGGGAATGAGTTAGGTGGCAGG + Intronic