ID: 1028590479

View in Genome Browser
Species Human (GRCh38)
Location 7:92488160-92488182
Sequence CAGGATGTATGTGGATAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028590479 Original CRISPR CAGGATGTATGTGGATAAAG GGG Intronic
900137610 1:1125020-1125042 CAGGAGGGATGTGGGGAAAGGGG + Intergenic
902660363 1:17896572-17896594 CAGGATGAATGAGGATGATGTGG + Intergenic
905007788 1:34724680-34724702 CAGGATGTTTGTGGAGAACTGGG + Intronic
909071767 1:71002940-71002962 CTGGATGTATGTGCATGAATTGG - Intronic
910802146 1:91157619-91157641 TAGGATGTATATATATAAAGGGG + Intergenic
912660239 1:111521407-111521429 GAGGATGTATGTGGAGAAACTGG - Intronic
915899046 1:159833388-159833410 CAGGAGGTAGGTGGAGGAAGTGG + Intronic
916435769 1:164776449-164776471 CAAGATATTTGTGGATCAAGAGG - Intronic
916999248 1:170338342-170338364 CAGGATGTATGAGTTTAAATCGG + Intergenic
918155188 1:181837889-181837911 CAGCAAGGATGTGGAGAAAGGGG + Intergenic
920913570 1:210239551-210239573 GAGGAAGTATGTGGAAGAAGAGG + Exonic
924170639 1:241336392-241336414 TAGGATGTATGTGAAAGAAGGGG + Intronic
924277656 1:242404623-242404645 TAGGACAAATGTGGATAAAGCGG - Intronic
1063264854 10:4436312-4436334 CAGGCAGTAGGTGGAGAAAGAGG + Intergenic
1065609087 10:27453183-27453205 CTGGAAGGATGTGGAGAAAGGGG - Intergenic
1065705161 10:28465591-28465613 TAGCATGTATGTGGAGAAAGGGG - Intergenic
1068027470 10:51665018-51665040 CAGAACGTTTGTGAATAAAGTGG - Intronic
1068054067 10:51989043-51989065 CTAGCTGTATGTGGATCAAGAGG - Intronic
1068344239 10:55751026-55751048 CAGGATGGATTTGGACAATGAGG + Intergenic
1068433940 10:56967033-56967055 CAGGATTTATGTGACTACAGTGG + Intergenic
1068774816 10:60858141-60858163 CAGGAGGTATTTGGATCATGGGG - Intergenic
1069652206 10:70057614-70057636 GAGGTTGTATGTGTGTAAAGGGG - Intronic
1069768354 10:70880822-70880844 CAGGATGTACTTGGATGAGGAGG + Exonic
1071512252 10:86269441-86269463 CAGAATGTGTGTGGGTGAAGGGG - Intronic
1071692735 10:87839379-87839401 CAGGATGTATGTGAAAGAAATGG - Intronic
1074636877 10:115329092-115329114 TGGCATGTATGTGGAGAAAGGGG - Intronic
1075357751 10:121797677-121797699 CATGATGGAGGAGGATAAAGCGG - Intronic
1075687350 10:124373572-124373594 CAGGATGTTTCTGGTTAAACAGG + Intergenic
1076677755 10:132156270-132156292 CAGGATGGAGGAGGATAAGGGGG - Intronic
1080682878 11:34492305-34492327 CATGATGGATGAGGATCAAGAGG + Intronic
1081084759 11:38785916-38785938 CAGCAAGGATGTGGAGAAAGAGG - Intergenic
1081740871 11:45439126-45439148 AAGGATGCATGTGGAATAAGGGG + Intergenic
1083604418 11:63969398-63969420 TAGGATATATGTATATAAAGGGG + Intergenic
1089016896 11:115172784-115172806 CAGGATGGAAGTGGCTCAAGGGG + Exonic
1092144570 12:6205575-6205597 CAGGATCTATGTGTGTAAGGGGG - Intronic
1092634891 12:10433060-10433082 CAGGATGGCTGTGGATGAGGAGG + Intronic
1093359417 12:18204362-18204384 CAGCATTTATTTGGAGAAAGTGG + Intronic
1094522307 12:31205322-31205344 TGGAATGTATGTGAATAAAGAGG - Intergenic
1099741277 12:86637806-86637828 TAAGATGTATGTAGATAACGTGG - Intronic
1100958474 12:99936130-99936152 CTGGATGTATGGGGATTATGAGG + Intronic
1101029138 12:100642965-100642987 CAGGATTAAAGTGGATAGAGGGG - Intergenic
1101584514 12:106073327-106073349 CAGGGTGTGAGTGGATACAGAGG - Intronic
1101655140 12:106713453-106713475 CAGGTCCTATGTAGATAAAGTGG + Intronic
1103258444 12:119563746-119563768 CAGGATGGATGTGGACCATGGGG + Intergenic
1103456201 12:121067922-121067944 GAGTATGAATTTGGATAAAGTGG - Intergenic
1103858154 12:123989200-123989222 CTGGCTGTATGTGGCTAGAGTGG + Intronic
1104584883 12:130039968-130039990 CAAGAAGGATGTGGAGAAAGTGG + Intergenic
1104897551 12:132171757-132171779 CAGGCTGTGTGTGGAGAAGGAGG - Intergenic
1104958280 12:132476421-132476443 CAGGATGTGACTGCATAAAGGGG - Intergenic
1106367042 13:29091378-29091400 CAGGATTTTTGTGGCTACAGAGG + Intronic
1106491065 13:30222438-30222460 CAGGATGTGTATATATAAAGAGG - Intronic
1109613133 13:64792883-64792905 CAAGATGTTTGTTGATGAAGGGG - Intergenic
1111583137 13:90250515-90250537 CAGCAAGTATATGGAGAAAGGGG - Intergenic
1111592116 13:90362012-90362034 TAGAGTGTATGTGGATAATGGGG + Intergenic
1112063188 13:95762631-95762653 CAGGATGTATGTGCAGAATGTGG + Intronic
1112986038 13:105451407-105451429 CAGTATGTGTGTGGGTAAATAGG - Intergenic
1116514763 14:45792047-45792069 CAGGATGCATTTGGAGAAAATGG + Intergenic
1119428153 14:74549458-74549480 CAGGAGGTAAGGAGATAAAGAGG + Intronic
1123411877 15:20067568-20067590 CAGGATTCATGTGGAGAAAGAGG - Intergenic
1123521221 15:21074687-21074709 CAGGATTCATGTGGAGAAAGAGG - Intergenic
1123578305 15:21694769-21694791 CAGGGTTCATGTGGAGAAAGAGG - Intergenic
1123614930 15:22137251-22137273 CAGGGTTCATGTGGAGAAAGAGG - Intergenic
1125041659 15:35195064-35195086 CAGGAAGGGTGTGGAGAAAGGGG - Intergenic
1126789074 15:52204256-52204278 CAGGCTGCATGTGGAGTAAGCGG - Intronic
1202987175 15_KI270727v1_random:429014-429036 CAGGGTTCATGTGGAGAAAGAGG - Intergenic
1133613922 16:7458047-7458069 CAGGAAGTATGTCCTTAAAGAGG - Intronic
1136418417 16:30117278-30117300 CAGGATGCCTGTGGATAAGGAGG + Exonic
1137063353 16:35811809-35811831 CAGGGTGAATGTGGATGAGGGGG + Intergenic
1137696493 16:50465406-50465428 CAGGGTGTGTTTGGAAAAAGTGG + Intergenic
1140626623 16:76802644-76802666 CAGGAGGTATTTCGATAATGTGG + Intergenic
1141070118 16:80946595-80946617 CAGGACAAATGTGGACAAAGAGG - Intergenic
1141235526 16:82212385-82212407 CAGGATGAATGTTGACTAAGGGG + Intergenic
1143995273 17:11001314-11001336 CAGGATGTTTGTTGATAATCTGG - Intergenic
1144415264 17:15040562-15040584 CTGCCTTTATGTGGATAAAGTGG + Intergenic
1149242590 17:54667837-54667859 TAGGATGACTGTGGAGAAAGAGG + Intergenic
1150051013 17:61962949-61962971 CACGATGGATCGGGATAAAGTGG - Exonic
1150903499 17:69311295-69311317 CAGGATTTACATGAATAAAGAGG + Intronic
1153199544 18:2634471-2634493 CAGGAGATATGTGGGTAAGGTGG + Intergenic
1153752135 18:8243461-8243483 CAGGCTGTAGGAGGATCAAGGGG - Intronic
1155611469 18:27672439-27672461 TAGATTGTATGGGGATAAAGAGG - Intergenic
1156486796 18:37471544-37471566 CAGGATCTAGGTGGATGGAGGGG - Intronic
1157249672 18:46083570-46083592 GAGGATGTACCTGCATAAAGAGG - Exonic
1159134433 18:64320494-64320516 CAGGATGAATGTGTATACATAGG - Intergenic
1163238654 19:16044798-16044820 CAGCAAGTATGTGGAGAAATTGG + Intergenic
925172291 2:1757619-1757641 CAGCATGTGTTTGGCTAAAGGGG + Intergenic
925834385 2:7929815-7929837 GAGGATGTTTGTGGCTAAATTGG + Intergenic
928585828 2:32757090-32757112 TAGGATGTAGTTTGATAAAGAGG + Intronic
929237447 2:39621184-39621206 CAGTATGTTTGTGGAAAAATTGG + Intergenic
930489910 2:52056328-52056350 CAAGATGATTGTGAATAAAGAGG - Intergenic
932323032 2:70835758-70835780 CAGGATGACTGTGGAGAAGGAGG - Exonic
933874569 2:86606148-86606170 CAGGAAGTATTTAGATTAAGAGG + Intronic
936651244 2:114428911-114428933 CAGGATAGATGTGGAGAAGGTGG - Intergenic
936659156 2:114523104-114523126 GAGGAAGGATGTGGATAAACAGG + Intronic
937444027 2:121941322-121941344 GAGGTTGCATGTGGAAAAAGAGG + Intergenic
938891222 2:135707089-135707111 CAGGAAGTTTGGGGATAAATGGG + Intronic
938918506 2:135969008-135969030 CAGCAAGGATGTGGAGAAAGTGG + Intronic
939939691 2:148334826-148334848 CAATATCTATGTGGAGAAAGTGG + Intronic
944664549 2:201949164-201949186 AAGGATGTTTGTGGAAAAACTGG - Intergenic
946126389 2:217566701-217566723 GAGGAGGTATGAGGATAAAGGGG + Intronic
947130007 2:226912172-226912194 TAGGATGTTTGTGAATAAAAAGG + Intronic
1168796620 20:614084-614106 TAGGGTGCATGTGGAGAAAGTGG - Intergenic
1169683045 20:8238635-8238657 CAGGATGAAAGGGGAAAAAGAGG + Intronic
1169719078 20:8652988-8653010 CAGAAAGTTTGTGGGTAAAGTGG - Intronic
1170246172 20:14223856-14223878 CAGGATGTATATATAGAAAGAGG + Intronic
1170886615 20:20345108-20345130 CAAGAAGTGGGTGGATAAAGTGG + Intronic
1171071842 20:22077234-22077256 CAGCATGGATGTGGAGAAAATGG - Intergenic
1172709732 20:36912263-36912285 AAGGAGGGAAGTGGATAAAGGGG - Intronic
1173535114 20:43803706-43803728 CAGCAAGGATGTGGATAAATTGG - Intergenic
1177501381 21:21960513-21960535 AAGGATGTATGTGAAGAAAGAGG - Intergenic
1182688903 22:32142389-32142411 CATGATGAATGTGAATAAAGTGG - Intergenic
1183392980 22:37556387-37556409 CAGGAAGTAGGTGGGTAAATGGG + Intergenic
950364125 3:12471204-12471226 CAGGAGCGATGTGGATACAGTGG - Intergenic
952723991 3:36562629-36562651 TAGTATGTATGTGGAAAAATAGG - Intergenic
952971082 3:38650611-38650633 AAGGTTGTATGTGGCTCAAGAGG - Intergenic
953131482 3:40143437-40143459 CAGGATGCATGTGGTTCATGGGG - Intronic
954740953 3:52750160-52750182 AAGGTTATATGTGGATAATGCGG - Intronic
955488071 3:59454777-59454799 CAGGATGTATGTGCATACAGAGG - Intergenic
957234798 3:77573019-77573041 CAGGAAGTTTGTAGAGAAAGAGG - Intronic
958860037 3:99435441-99435463 CAGGAGGTATTTGGATCATGGGG + Intergenic
959652298 3:108762790-108762812 CATGATGTATCTGGAAAAAAAGG + Intergenic
959688087 3:109169351-109169373 CAGGTTGTAAGTGAATATAGAGG + Intergenic
960463961 3:117972328-117972350 CAGGCTTCGTGTGGATAAAGGGG - Intergenic
961463304 3:127066809-127066831 CAGGCTGCATGTGGACAGAGAGG - Intergenic
962372508 3:134832528-134832550 CAGTTTGTATGTGGGTAAGGGGG - Intronic
962790041 3:138802922-138802944 AAAGGTGTATGTGAATAAAGCGG + Intronic
963455500 3:145541619-145541641 CAGCATGGATGTGGAGAAAAGGG - Intergenic
964328159 3:155571085-155571107 CAGGAAGTCTGAGGATAAATAGG - Intronic
969939168 4:10713249-10713271 CCAGTTGTATGTGGATAAACTGG + Intergenic
971110017 4:23574273-23574295 CAGGATGCAATTGGAGAAAGTGG - Intergenic
971364244 4:25964777-25964799 TAGAATGTCTGTGGTTAAAGTGG + Intergenic
971598777 4:28567231-28567253 CTGGAGGTCTGTGGCTAAAGTGG - Intergenic
971602601 4:28614375-28614397 AAGATTGTATGTGGATAATGAGG + Intergenic
973203448 4:47531868-47531890 CAGGATGTATTTGGTTTATGCGG + Intronic
975695941 4:77013070-77013092 CAGAATGTCTGTGGAGAATGGGG - Intronic
976306234 4:83562442-83562464 CAGGATGTGTGTGGGAGAAGTGG + Intronic
977354778 4:95931979-95932001 CAGGATATAATTGGATAAAATGG + Intergenic
982977013 4:162076616-162076638 CAAGACTTCTGTGGATAAAGTGG + Intronic
989714060 5:44438877-44438899 CATTTTGCATGTGGATAAAGTGG + Intergenic
989715378 5:44456112-44456134 CAGGATGCAACTGGATAAATTGG - Intergenic
990728538 5:58783777-58783799 AATGTTGTTTGTGGATAAAGGGG - Intronic
993321146 5:86468638-86468660 CAGGAAGAATTTAGATAAAGCGG - Intergenic
993677086 5:90829632-90829654 GAGGATGGATGTGAAAAAAGTGG - Intronic
996338567 5:122411526-122411548 AAGGAGATATGTGGATAAAAAGG - Intronic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
1000157354 5:158564625-158564647 CAGGAAGCATGTGAATCAAGGGG - Intergenic
1000608312 5:163348328-163348350 CAGGCTGTATCTGCATGAAGAGG - Intergenic
1001222456 5:169913399-169913421 CAGGGTGTTTTTGGAGAAAGAGG - Intronic
1005267725 6:24130059-24130081 CAGGAGGTACATGGATAGAGGGG - Intronic
1005658758 6:27971326-27971348 TAGCATGGATGTGGAGAAAGGGG + Intergenic
1005951270 6:30633122-30633144 CAGATTGTATGTGGAGAAAGAGG + Intronic
1006125839 6:31837528-31837550 CAGGATGAAGGTGGATCAGGTGG - Intronic
1007340882 6:41191006-41191028 CAGGATGGATGTGGGGAGAGTGG - Exonic
1008225479 6:48909837-48909859 CAGGTTGTTTTTGTATAAAGGGG - Intergenic
1010823715 6:80447270-80447292 CATGATGTATGTGAAAGAAGTGG + Intergenic
1011520883 6:88204634-88204656 CAGGATCTTTGTTGAAAAAGGGG - Intergenic
1012585266 6:100914014-100914036 CAGACTGTATGTGGAGAAATGGG - Intergenic
1014549681 6:122776035-122776057 CAGTAAGAATGTTGATAAAGGGG + Intergenic
1015943231 6:138473232-138473254 AAGGATATATGTGGACAAACTGG - Intronic
1016437624 6:144053612-144053634 CAGGACTTATTTGGATAAAAAGG + Intronic
1018291178 6:162293689-162293711 CAGGAGGAATGTGAATACAGTGG + Intronic
1022238587 7:28487415-28487437 GATGATGTATTTGGATCAAGGGG + Intronic
1027507548 7:79036494-79036516 CAAGTTGGCTGTGGATAAAGAGG + Intronic
1028311928 7:89349328-89349350 CAGCATGTCTGTGGAAGAAGAGG + Intergenic
1028590479 7:92488160-92488182 CAGGATGTATGTGGATAAAGGGG + Intronic
1029054268 7:97724025-97724047 CAGGATGTGTGTGGAGAAAGAGG + Intergenic
1029708933 7:102289207-102289229 CCGGAAGTATGTGGAGAATGGGG - Intronic
1030308994 7:108050103-108050125 CAGGCAGTATGTAAATAAAGAGG + Intronic
1030477244 7:110051348-110051370 AAGAATGTATGTGCAAAAAGGGG + Intergenic
1031427758 7:121627484-121627506 CAGGTTGTATGTGCATGAGGCGG + Intergenic
1031637095 7:124114980-124115002 CACGGTGGATTTGGATAAAGTGG - Intergenic
1031926487 7:127643553-127643575 CAAAATGTCTGGGGATAAAGGGG + Intergenic
1034279154 7:149839490-149839512 CTGGAAGTATGAGGATAAATAGG + Intronic
1036294855 8:7527547-7527569 TTGGATGTATGTGGTTAAATAGG - Intergenic
1036327708 8:7793444-7793466 TTGGATGTATGTGGTTAAATAGG + Intergenic
1037238640 8:16751938-16751960 CATGGTGTATGTGGAGAAATAGG - Intergenic
1039583846 8:38688756-38688778 CAGGAGGTATGAGAACAAAGGGG - Intergenic
1039816316 8:41097655-41097677 TAGGATGGAAGTGGAGAAAGGGG + Intergenic
1041537896 8:58948275-58948297 CTGGAAGTATGTGGAGAGAGAGG - Intronic
1041864993 8:62562149-62562171 AAGAATATATGTGTATAAAGAGG - Intronic
1042368353 8:67962498-67962520 CCAGAGGTATGTGGATGAAGGGG + Intronic
1044126190 8:88460192-88460214 CAGGAGGTCTGTAGATACAGGGG - Intergenic
1044493091 8:92844231-92844253 CAGGATGGAGGTGGTGAAAGGGG + Intergenic
1045164123 8:99583786-99583808 CAAAATGCATGTGGGTAAAGGGG + Intronic
1045911871 8:107419399-107419421 CAGGATGAATCTGCATAAACAGG + Intronic
1048098131 8:131316516-131316538 CAGTATGTACGGGGGTAAAGAGG - Intergenic
1050494946 9:6230732-6230754 GAGGATCTATGAGGATATAGTGG - Intronic
1050682560 9:8130243-8130265 TAGGAAGGATGTGGAGAAAGGGG - Intergenic
1052254582 9:26439728-26439750 CAGAATGTATTTGGAAAGAGAGG - Intergenic
1052269926 9:26616791-26616813 CAGAATGTGTGAGGACAAAGGGG - Intergenic
1053337934 9:37294169-37294191 AAGAATGTAAGTGAATAAAGTGG + Intronic
1056573493 9:87836413-87836435 CAGTTTGTATGTGGAGAGAGGGG - Intergenic
1057775200 9:98002184-98002206 CAAAATGTATGTGGTTAATGAGG - Intronic
1058789321 9:108425897-108425919 TAGGATAAATGTGGATAATGTGG - Intergenic
1059038811 9:110789843-110789865 AAGGATGCATGTGGATATGGAGG + Intronic
1059206214 9:112468648-112468670 CAGGATGCAGGTGGAGAAAGAGG - Intronic
1186898728 X:14031307-14031329 CAGAAAGTATGTGTATATAGAGG + Intergenic
1188151539 X:26681901-26681923 CAGGGAGAATGTGGATAAAAGGG + Intergenic
1188288535 X:28360096-28360118 CATGATGTAAATGGATGAAGGGG - Intergenic
1188640092 X:32490406-32490428 CAAGATGTAAGTGGACAAAAGGG - Intronic
1189658845 X:43277329-43277351 CAGCATGGATGTGGAGAAAGGGG - Intergenic
1189711893 X:43821583-43821605 AAGGATGGATGGGGATAGAGAGG + Intronic
1189820210 X:44863117-44863139 CAGCATGAAAGTGTATAAAGTGG + Intergenic
1190006698 X:46746648-46746670 CAACATGGATGTGGAGAAAGGGG + Intronic
1190592068 X:52013306-52013328 TAGGATGTGTTTGGAAAAAGGGG + Intergenic
1192897929 X:75463793-75463815 CAGGAGGGATGTGGAGAAATAGG + Intronic
1196622902 X:117844117-117844139 TGGCATGTATGTGGAGAAAGGGG + Intergenic
1198401960 X:136277338-136277360 CAGGATGCATTGGGTTAAAGTGG + Intergenic