ID: 1028590984

View in Genome Browser
Species Human (GRCh38)
Location 7:92494325-92494347
Sequence CTAGTCGACCAGGCCTAAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 30}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028590982_1028590984 10 Left 1028590982 7:92494292-92494314 CCTGATCAGGAGGAGGACAGTAT 0: 1
1: 0
2: 0
3: 13
4: 118
Right 1028590984 7:92494325-92494347 CTAGTCGACCAGGCCTAAGCAGG 0: 1
1: 0
2: 1
3: 0
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028590984 Original CRISPR CTAGTCGACCAGGCCTAAGC AGG Exonic
912958620 1:114174777-114174799 TTAGTCAACAATGCCTAAGCAGG + Intergenic
919403856 1:197151659-197151681 CTACAAGACCAGGGCTAAGCAGG + Intergenic
1071498961 10:86190138-86190160 CTAGTCGCCCACCCCCAAGCAGG + Intronic
1073920329 10:108451083-108451105 GAAGTTGACCAGGCCTAGGCTGG - Intergenic
1077649682 11:3958913-3958935 CTTGTCGCCCAGGCCCAGGCTGG - Intronic
1133231845 16:4370694-4370716 CTAGCCGTCAAGGGCTAAGCAGG - Intronic
1138916891 16:61475289-61475311 CTAGTCCCCCACCCCTAAGCAGG - Intergenic
1139473786 16:67192395-67192417 CTGGTGGACCAGGCCTGGGCCGG + Intronic
1139584594 16:67893613-67893635 CACGTCCACCAGGCCCAAGCGGG - Intronic
1150515685 17:65807525-65807547 CTAGTCCTCCAGGCCTATGGTGG - Intronic
1153015985 18:582983-583005 CTAGTGGAACAGGTCTAAACTGG + Intergenic
947521616 2:230850102-230850124 CTACTCTACCAGGCCCAGGCAGG - Intergenic
1182329341 22:29539563-29539585 CCTGTAGACCAGGACTAAGCAGG - Intronic
1184881360 22:47306469-47306491 CAGGTCGACCAGGCCTACCCAGG - Intergenic
1184911627 22:47539145-47539167 CTCTTAGACCAGGCCTAACCAGG + Intergenic
953913297 3:46903574-46903596 CTCCTCGTCCAGGCCTGAGCAGG - Exonic
963200217 3:142578722-142578744 CTAGTCAACCACGCCAACGCGGG + Exonic
983669044 4:170215045-170215067 CTAGTCCTCCAGGCCTATGATGG - Intergenic
985809889 5:2075214-2075236 CCAGTGGACAAGGCCTAGGCTGG + Intergenic
996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG + Exonic
1000874010 5:166613069-166613091 CTAGTGGGCCTGACCTAAGCTGG - Intergenic
1016580873 6:145628406-145628428 AGAGTCTACCAGGCCTCAGCAGG - Intronic
1028590984 7:92494325-92494347 CTAGTCGACCAGGCCTAAGCAGG + Exonic
1035207943 7:157306958-157306980 CAAGTCCACCAGGGCTCAGCGGG - Intergenic
1043853377 8:85239300-85239322 GTAGTCAAGCAGACCTAAGCAGG + Intronic
1048708953 8:137186470-137186492 CTGGTGGACCAGGCCAAAGAAGG + Intergenic
1052093492 9:24357364-24357386 CTAGTCTACCGGGCCTAGGATGG + Intergenic
1055261358 9:74437568-74437590 CAAGTCAACCAGGCCTAAGCTGG + Intergenic
1185557324 X:1031718-1031740 CTGGTGGACCAGGCCCAGGCGGG - Intergenic
1191108322 X:56786150-56786172 CAAGTCTACAAGGCCAAAGCAGG - Intergenic
1194526544 X:94983978-94984000 CTATTCTACCATGGCTAAGCTGG - Intergenic
1196968558 X:121084464-121084486 CTAGTCGACCTGCCCCAAGAGGG - Intergenic