ID: 1028591103

View in Genome Browser
Species Human (GRCh38)
Location 7:92496261-92496283
Sequence CTGTATATGAATACAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 270}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028591103_1028591104 23 Left 1028591103 7:92496261-92496283 CCATCTTCTGTATTCATATACAG 0: 1
1: 0
2: 2
3: 20
4: 270
Right 1028591104 7:92496307-92496329 TACACTCACTGAAATTAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028591103 Original CRISPR CTGTATATGAATACAGAAGA TGG (reversed) Intronic
901829035 1:11880910-11880932 GTTTATCTGAACACAGAAGATGG - Intergenic
903858154 1:26349372-26349394 CTGGATGTGAAATCAGAAGATGG - Intronic
907172500 1:52482257-52482279 TTGTATATGAGTATAGAAAAAGG - Intronic
908144020 1:61218688-61218710 CTGTAGAAGAATACATAATAGGG - Intronic
908169776 1:61493166-61493188 AAGTATATTAATACAAAAGAGGG + Intergenic
908457963 1:64322417-64322439 CTGAATATGAATAAGGCAGAGGG + Intergenic
908856294 1:68433452-68433474 CAGTATATGAGTACAGATGCTGG + Intronic
912578921 1:110703012-110703034 ATGTATTTGAATAATGAAGAGGG - Intergenic
912623788 1:111191405-111191427 CTGTATCTCAAGCCAGAAGAGGG - Intronic
913498335 1:119448478-119448500 GTGTATATTAATACAGAGAATGG + Intergenic
913509368 1:119548126-119548148 GTGTATATGAATACAGACAATGG + Intergenic
914327124 1:146630040-146630062 CTGGCTTTGAACACAGAAGAAGG - Intergenic
915002439 1:152605766-152605788 ATGTCTATGAACACAGAAGAGGG - Intergenic
915944288 1:160138534-160138556 TTGTGTAAGAATACAAAAGATGG + Intronic
916569893 1:166016078-166016100 CTATATCTAAATACAGAAGGGGG + Intergenic
918441821 1:184575588-184575610 CTGTATGTGAAAACACAAAAAGG + Intronic
922885121 1:229014001-229014023 CAGTGTATGAAAACAAAAGAGGG - Intergenic
923028496 1:230226390-230226412 CTGTATATGAATGGAGAAATGGG + Intronic
1063029355 10:2216712-2216734 CTGAATATGAAAAATGAAGATGG + Intergenic
1063817848 10:9796801-9796823 CTGCTCTTGAATACAGAAGACGG - Intergenic
1063944353 10:11162515-11162537 CTCTGTAGGAATAGAGAAGAAGG + Intronic
1064599321 10:16977296-16977318 GTTTATATGAATACAGGATAAGG - Intronic
1065387974 10:25152486-25152508 CTGTCTATGAACAAAGAAGTGGG - Intergenic
1067370588 10:45678474-45678496 CTGTAGGTGACTACAGAAGGAGG + Intergenic
1067389193 10:45847682-45847704 CTGTAGGTGACTACAGAAGGAGG - Intronic
1067416877 10:46109276-46109298 CTGTAGGTGACTACAGAAGGAGG + Intergenic
1067445064 10:46336867-46336889 CTGTAGGTGACTACAGAAGGAGG + Intergenic
1067592308 10:47523861-47523883 CTGTAGGTGACTACAGAAGGAGG - Intronic
1067639424 10:48031934-48031956 CTGTAGGTGACTACAGAAGGAGG - Intergenic
1067874071 10:49988371-49988393 CTGTAGGTGACTACAGAAGGAGG + Intronic
1068038050 10:51785731-51785753 CTGTATTTGAATAAACATGATGG + Intronic
1068709206 10:60114792-60114814 TTGTATCTGAATGCAGCAGAGGG + Intronic
1068740808 10:60467829-60467851 CTGTTTATGAATACATAAGTTGG + Intronic
1069206108 10:65688172-65688194 CAGTATATGAATCCTGACGATGG - Intergenic
1069390019 10:67925514-67925536 CTGTTCATGAATACAGAGAAAGG - Intronic
1070136411 10:73698084-73698106 CTGTAGGTGACTACAGAAGGAGG - Exonic
1070276435 10:75012136-75012158 CTATACTTGAAGACAGAAGAAGG + Intronic
1070641666 10:78174833-78174855 CCCTCTATCAATACAGAAGATGG + Intergenic
1073715506 10:106102097-106102119 CTGTATCTGAAAACTGGAGATGG - Intergenic
1075142219 10:119849134-119849156 CTGGCTATGAATATGGAAGAAGG + Intronic
1075535900 10:123271892-123271914 ATGTATATATATATAGAAGAAGG - Intergenic
1077561005 11:3261012-3261034 CTGTTTAGGAACACTGAAGAAGG - Intergenic
1077566902 11:3306842-3306864 CTGTTTAGGAACACTGAAGAAGG - Intergenic
1082090828 11:48088467-48088489 CTGCATATGTTTGCAGAAGAAGG + Intronic
1085214668 11:74818363-74818385 CTGTATATTAAAACAGAGCACGG - Intronic
1086375652 11:86197741-86197763 ATGTATATATATACAGAAGGTGG + Intergenic
1086737972 11:90330165-90330187 ATGTATATGAATAAATAATAAGG - Intergenic
1086852824 11:91831017-91831039 TTGGATATTTATACAGAAGAGGG - Intergenic
1087864960 11:103214002-103214024 TTGTATATGATGACAGAAGGAGG + Intronic
1088133418 11:106524052-106524074 CAGTAAATGAATACTTAAGAAGG + Intergenic
1088657500 11:112014574-112014596 CTGTATTGGAAGACTGAAGATGG - Intronic
1089168561 11:116496931-116496953 CTGAATTTGAAGACAGAAAAAGG + Intergenic
1090819686 11:130330309-130330331 CTGTATCTGATTTCAGGAGATGG + Intergenic
1091419409 12:323050-323072 CAGTATATGCATACAAAAGAAGG + Intronic
1092891093 12:12969937-12969959 CTGTATATAAATACAGTGGAAGG - Intergenic
1094628077 12:32144877-32144899 TTGTATTTGAATAGAAAAGAGGG - Intronic
1095366171 12:41408560-41408582 CTGAATATGAGCACAGAAGATGG + Intronic
1095914286 12:47460483-47460505 CAGAATATGAAAACAGTAGAAGG - Intergenic
1098288055 12:68928684-68928706 TTGTATCTGAATACAGTAGGCGG - Intronic
1098426812 12:70373404-70373426 CTAGCTTTGAATACAGAAGAGGG + Intronic
1099673282 12:85722541-85722563 CTGTATAAGAAAATAGAAAAAGG + Intergenic
1105760904 13:23513633-23513655 CTGTCTAGAAATACAGAGGAGGG + Intergenic
1107456754 13:40562625-40562647 CTGAATAGGAATAGAGAAGCAGG - Intronic
1109304918 13:60627716-60627738 GTTTATAGGAATTCAGAAGATGG + Intergenic
1109495491 13:63165787-63165809 CTCTATAGCACTACAGAAGAGGG - Intergenic
1109756946 13:66773721-66773743 CTGTATTAGAAAGCAGAAGATGG + Intronic
1110267307 13:73552906-73552928 CTATATATGAATATAAAATAAGG - Intergenic
1112558677 13:100492694-100492716 GTTTATATGGATACAGGAGAGGG - Intronic
1113203696 13:107893376-107893398 GTGTATGGGAATACAGAAGAAGG + Intergenic
1113332112 13:109339101-109339123 CTTTAAATGATTACATAAGAAGG - Intergenic
1114243108 14:20887555-20887577 CTGTTTATTGATACAGAATAGGG - Intergenic
1114637778 14:24197894-24197916 TTCTATTTGAATACAGAATAGGG - Intronic
1114713396 14:24801311-24801333 AAGTATATAAAAACAGAAGAGGG + Intergenic
1115375240 14:32668043-32668065 CTGTAGAGGAATTTAGAAGATGG + Intronic
1115388050 14:32820813-32820835 CTGAATAGGAACACAGAGGAAGG + Intronic
1116698794 14:48210786-48210808 TTGTATCTGGATACAGAAGGTGG + Intergenic
1117867624 14:60165748-60165770 CTGAATAGGAATGGAGAAGAGGG - Intronic
1119044721 14:71308460-71308482 CTGTATTTCAATACAATAGAAGG + Intergenic
1119116313 14:72025078-72025100 CTGTATATAAAGACAGAAAGAGG + Intronic
1120113835 14:80590508-80590530 CTGTTTAGGAATAAAGATGAAGG + Intronic
1120210360 14:81628244-81628266 CTGTCCATGGAGACAGAAGAAGG - Intergenic
1120614824 14:86690306-86690328 CTGTCTATGAATCAGGAAGAAGG + Intergenic
1122106033 14:99455712-99455734 CTGTATATAAATACAAAGCAGGG + Intronic
1125705449 15:41731117-41731139 CTGTATTTTAAAACAGAATAAGG + Intronic
1125709014 15:41768630-41768652 CTGTCAATGAAGACAGAACAGGG - Exonic
1127197131 15:56600058-56600080 CTGTAAAGGAATACCTAAGAGGG + Intergenic
1127903065 15:63355279-63355301 CTGTATAGGAGCACAGAAGAGGG - Intronic
1128647097 15:69385715-69385737 GTGTATATGAAGAAAGAGGATGG - Intronic
1129022932 15:72539817-72539839 CTCTATATGAATATTGAGGAGGG + Intronic
1129565222 15:76614942-76614964 CTACTTATGAATACATAAGAAGG + Intronic
1130090800 15:80819605-80819627 CTGTTTATGAATGCTGTAGAGGG - Intronic
1130242126 15:82203863-82203885 CTGTTTATGAAAGCAGAAAAAGG - Intronic
1130458249 15:84136962-84136984 CTGTTTATGAAAGCAGAAAAAGG + Intergenic
1133544233 16:6789559-6789581 CTGTCTATGGATACAGAAAATGG - Intronic
1137635440 16:49982326-49982348 CTGTATATGGATGGAGATGATGG + Intergenic
1138406448 16:56798557-56798579 ATGTAGATGTATACAGATGAGGG + Intronic
1139538512 16:67595563-67595585 CGGTATAAGGATACAGAGGATGG + Intronic
1139928690 16:70507282-70507304 CTGTATCGGTATACACAAGAGGG + Intronic
1140006436 16:71080899-71080921 CTGGCTTTGAACACAGAAGAAGG + Intronic
1142945000 17:3418762-3418784 TTGTATCTGAAATCAGAAGATGG - Intergenic
1143960348 17:10712207-10712229 CTGGCTTTGAAGACAGAAGAAGG - Intronic
1144405037 17:14944081-14944103 CTGTATGTTAATACATAGGAAGG - Intergenic
1146922693 17:36723746-36723768 CTGTACAGGAGAACAGAAGAAGG - Intergenic
1147469481 17:40646495-40646517 CTGTATAGGAATACAGATGGGGG - Intronic
1150988729 17:70230265-70230287 CTGGATACGAACAGAGAAGAGGG + Intergenic
1155086578 18:22464703-22464725 CTGTAGAGGAATACAGGAAAGGG - Intergenic
1155755167 18:29484567-29484589 ATGTAAATCAATACAGAAAATGG - Intergenic
1156148439 18:34214651-34214673 CTGGATATGTACACAGAAGCAGG - Intronic
1156846735 18:41674394-41674416 CTGTAGATGGATCCACAAGAAGG - Intergenic
1157306333 18:46520234-46520256 TTGTATATGGAAACAGAAGTGGG - Intronic
1158267157 18:55672370-55672392 CTGTGCAGGAAAACAGAAGAAGG - Intergenic
1158379675 18:56915516-56915538 CTGGATCTGAATAGTGAAGAAGG - Intronic
1158798591 18:60878565-60878587 GTGTATATACATAGAGAAGATGG + Intergenic
1158814403 18:61077027-61077049 CTGAATATAAATATAGAGGATGG - Intergenic
1159135117 18:64328444-64328466 CTGTGTATGCATAGAGAAAATGG - Intergenic
1159217212 18:65408631-65408653 CTGTATATGAATATAAACTATGG + Intergenic
1159677291 18:71301272-71301294 CTGTAAATACATACAGAAGATGG - Intergenic
1160164583 18:76498803-76498825 CTGTATTTGAATATGGAGGAGGG + Intergenic
1160265293 18:77336543-77336565 CTGGCTTTGAAGACAGAAGAAGG + Intergenic
1162011163 19:7815948-7815970 TTGTATATGGGTTCAGAAGATGG - Intergenic
1162275454 19:9650474-9650496 CTGTATGTGAAAAGAGAAGGGGG + Intronic
1165847311 19:38826646-38826668 GTGTAGGGGAATACAGAAGAAGG - Intronic
1168029911 19:53671256-53671278 CTGTCTATGAACACAGAAGAAGG - Intergenic
1168154428 19:54465043-54465065 CCGTTTATGTATACAGAAGTGGG + Exonic
925836938 2:7955364-7955386 CTATATTTGAATGCAGAACAGGG + Intergenic
926851478 2:17202907-17202929 CAGAATAGGAAAACAGAAGAGGG - Intergenic
927684957 2:25164082-25164104 CTGTAGAGGAACACAGCAGAAGG + Intronic
928791946 2:34967973-34967995 TTATATATGAATAAAGAAAATGG - Intergenic
930270485 2:49250799-49250821 CGGTTTATGAAGAGAGAAGAAGG + Intergenic
930483634 2:51983723-51983745 CTGTAGTTGAATACTGGAGAAGG + Intergenic
931612910 2:64123111-64123133 CTGTGTATTATTACAGGAGATGG + Intronic
932604541 2:73156450-73156472 TCGGATAGGAATACAGAAGAGGG - Intronic
932775668 2:74526940-74526962 CACTATATGAATACGCAAGAAGG - Exonic
934719400 2:96562829-96562851 CTGGCTTTGAAGACAGAAGAAGG + Intergenic
936605513 2:113948509-113948531 CTGTCTGTGATGACAGAAGAAGG - Intronic
937512104 2:122607486-122607508 CTAAATTTGAATACAGTAGAGGG - Intergenic
939255089 2:139733024-139733046 CTGTATATGACTAAAGACAATGG + Intergenic
940138458 2:150465488-150465510 CTGTCTTTGAAGACAGAAAAAGG - Intergenic
940278951 2:151969608-151969630 CTGTATATGAATGTAGGTGAAGG + Intronic
940385055 2:153061084-153061106 ATTTATATGCATACAGATGAAGG - Intergenic
941051731 2:160742113-160742135 CTGTTTATGTAAACAGTAGATGG + Intergenic
941453632 2:165690666-165690688 CTGTATAGGAGTTCAGATGAGGG + Intergenic
941656154 2:168146820-168146842 CTGTATATGAATAGAGAGGTTGG + Intronic
942014878 2:171803027-171803049 ATGTATATGAAAACATTAGAAGG + Intronic
942898411 2:181086033-181086055 CTGTAGAGGAATAGAGAGGATGG + Intergenic
942960540 2:181825204-181825226 GTGTATAGGATTACAGAAGAAGG - Intergenic
943184439 2:184588457-184588479 TTGTTTATGAATACAGAGGCAGG + Intergenic
945463891 2:210144936-210144958 CAGTATATGAAGTCAGAAGGAGG - Intronic
946970922 2:225090120-225090142 CTGAACAGGAAAACAGAAGAGGG - Intergenic
947059496 2:226146612-226146634 CTGGAAATGAGTACAGAAAATGG + Intergenic
947129138 2:226903788-226903810 GTTTATATGGATACAGGAGAGGG - Intronic
947355281 2:229288222-229288244 CTGTATATCACTACAAATGAAGG - Intergenic
948972772 2:241441991-241442013 GTAGATATGAACACAGAAGACGG + Intronic
1170020504 20:11832132-11832154 CTGTATTTCTATAGAGAAGATGG - Intergenic
1171336127 20:24387387-24387409 CTGAATATGAAGACAGATTAGGG + Intergenic
1173736875 20:45368081-45368103 CTGTATTTGTATACACAGGAAGG - Exonic
1173832809 20:46102889-46102911 CTGGCTTTGAAGACAGAAGATGG + Intergenic
1174135954 20:48379629-48379651 CTGAGTCTGAAGACAGAAGAAGG - Intergenic
1174430808 20:50467339-50467361 CTGTATTTAAATCCAGAAGTAGG + Intergenic
1175432468 20:58915661-58915683 CTGTCTAAAAAGACAGAAGAAGG - Intergenic
1179336192 21:40457205-40457227 CTGTATTTGGAAAAAGAAGAAGG + Intronic
1181048388 22:20227309-20227331 CTGTACATGCATACAGTTGAGGG - Intergenic
1183318785 22:37151733-37151755 TTGTATATGAAGAGAGATGAGGG + Intronic
1184932575 22:47692105-47692127 CTGTATAGTAATACAGAAGAGGG + Intergenic
1185160528 22:49225575-49225597 TAGTATATTAATAAAGAAGAAGG - Intergenic
951499578 3:23369737-23369759 CTGTATATGACTGCTGAAGTAGG - Intronic
951604209 3:24414259-24414281 CTTTATATTAATTCAGAAGATGG + Intronic
955893235 3:63672527-63672549 CTGAAAATGAAAACAGAAGCCGG + Intronic
957263597 3:77931461-77931483 GTGTCTATGAAAGCAGAAGAAGG + Intergenic
958528913 3:95298861-95298883 CAGTAGAAGAGTACAGAAGAGGG + Intergenic
960009214 3:112814980-112815002 CTCTATATGAACACATGAGAGGG + Intronic
960556827 3:119039361-119039383 CTGGATTTGAAGATAGAAGAAGG - Intronic
962411091 3:135142523-135142545 ATGGATATGAATAAAGGAGAAGG + Intronic
963316323 3:143762671-143762693 CTGTGTATGAACACAGCACAAGG + Intronic
963686981 3:148448157-148448179 GTGTATGTGAAGGCAGAAGAGGG + Intergenic
965233672 3:166087436-166087458 ATGAATATGAAAACAGGAGAAGG - Intergenic
965678646 3:171227505-171227527 TTGCATATGAATGCAGAACAAGG - Intronic
965994062 3:174857140-174857162 CTGCATATGAATTCAGCAAAAGG + Intronic
967078931 3:186030977-186030999 CTTTATACTAATAAAGAAGAAGG - Intergenic
967155620 3:186689060-186689082 CTGTGTAAGATTACACAAGAGGG + Intergenic
967227068 3:187302210-187302232 CTGGATAAGAATGAAGAAGAGGG - Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
969067824 4:4502782-4502804 CTGCATAGGAAGACAGATGAAGG - Intronic
970427837 4:15962409-15962431 CTGTATATGAGTAAAGGAAAGGG + Intronic
970509432 4:16766219-16766241 ATGTATATTAATATAAAAGATGG - Intronic
973757039 4:54085382-54085404 CTGTGTATGCATACAGAATTAGG + Intronic
974838640 4:67278368-67278390 GTGCAGAGGAATACAGAAGAAGG + Intergenic
977646040 4:99413700-99413722 ATGTATTTTAATACAGAAGGTGG + Intronic
979266888 4:118714122-118714144 CTCTATATTAATAGAGAAGCAGG + Exonic
980613412 4:135186538-135186560 CTGTAAATATATACAGGAGAAGG + Intergenic
981151905 4:141388657-141388679 CTTTGTATGTATTCAGAAGAGGG + Intergenic
983394372 4:167174991-167175013 CTGTATCCTACTACAGAAGAAGG - Intronic
983898535 4:173107354-173107376 CTGAAAATGAATTCTGAAGAAGG + Intergenic
984650734 4:182268184-182268206 TTGTATAGGAATACAGGACAAGG + Intronic
984667238 4:182441999-182442021 CTGAATGGGAATGCAGAAGAGGG + Intronic
987368409 5:17170938-17170960 CTGTACAGGAATAGACAAGACGG - Intronic
987396354 5:17428317-17428339 CCGCATATGAATACAGCAAATGG + Intergenic
987966579 5:24884889-24884911 TTCTATCTGAATACAGTAGAGGG + Intergenic
988922872 5:35961005-35961027 ATTTATATGAGTACAGGAGAGGG + Intronic
990664817 5:58060444-58060466 TTGTAAATGAACACAGAAAAAGG + Intergenic
990853576 5:60236755-60236777 CTGGATTTGAAGACAGAGGAAGG + Intronic
991388349 5:66115233-66115255 ATGAAAAAGAATACAGAAGAAGG - Intergenic
992275054 5:75106940-75106962 CTGAATGTGAATAAAGAATAGGG + Intronic
994253257 5:97562299-97562321 CTATACATGAATAAAGAAGAGGG - Intergenic
994335326 5:98558257-98558279 CTGTATAGGAATGAAGAGGAGGG + Intergenic
994540032 5:101083003-101083025 ATCTATATAAATACAGAAAACGG - Intergenic
994805046 5:104434969-104434991 ATACATATGAATACATAAGAAGG + Intergenic
995175383 5:109170520-109170542 TTGTATATGGATACAGAAACAGG - Intronic
995652499 5:114385731-114385753 CGGGATACTAATACAGAAGAAGG - Intronic
996546788 5:124687843-124687865 CTGTATATAACTACAGCAGGAGG - Intronic
998553153 5:143097035-143097057 CTGTATTTGAGTCCAGAAAATGG - Intronic
998619150 5:143775174-143775196 CTTTATATGAATACTAATGAGGG - Intergenic
999063143 5:148656389-148656411 CTGGCTTTGAAGACAGAAGAAGG + Intronic
999894714 5:156018779-156018801 CTGTGTATGAATGCTGAAGTAGG - Intronic
1000085433 5:157883958-157883980 GTGCAGAGGAATACAGAAGAAGG - Intergenic
1000269946 5:159674500-159674522 CTCTATAAAAATACAGAAGTTGG + Intergenic
1000905392 5:166959997-166960019 CTGTATATGAATAGAGACACAGG + Intergenic
1001417975 5:171561547-171561569 CTGAATATGAATACACAAACAGG - Intergenic
1009287855 6:61844752-61844774 CTTTACATGATTTCAGAAGAAGG - Intronic
1009460106 6:63902844-63902866 CAGTATATGAATAAAGATGTAGG + Intronic
1011304582 6:85911861-85911883 CTGTATAATAAAAAAGAAGAGGG + Intergenic
1011700030 6:89947537-89947559 CTGTTCAGGAATGCAGAAGATGG + Intronic
1012166079 6:95954068-95954090 CTGGTTATAAAAACAGAAGAGGG - Intergenic
1012199054 6:96382763-96382785 CTGTGTATGAAGACATAAAATGG + Intergenic
1012242484 6:96889380-96889402 GTAGATATGAATAAAGAAGATGG + Exonic
1012700766 6:102453817-102453839 CTGTAGATAACTACAGAAAAAGG - Intergenic
1013841186 6:114396606-114396628 ATGTATATAGATACACAAGAGGG + Intergenic
1014463289 6:121725054-121725076 TTGTATATGAAAGCAGAAGATGG - Intergenic
1015084718 6:129276276-129276298 CTGTATTTGCATACACAACAGGG - Intronic
1016827027 6:148397938-148397960 CTGTGCAGGAGTACAGAAGAGGG + Intronic
1017791760 6:157805817-157805839 ATGTAAAAGAATACAGAAGAAGG - Intronic
1021899843 7:25274123-25274145 ATGTTTTTGAAAACAGAAGATGG + Intergenic
1022819712 7:33947339-33947361 CTCTATATGAGGAAAGAAGATGG - Intronic
1023478493 7:40606937-40606959 ATGCATATGAATACATAAAAAGG - Intronic
1024400523 7:48919583-48919605 CTGTATAAGAATACTGGAGTAGG - Intergenic
1024789876 7:52953316-52953338 CTGTATATGACTTCTGAAAAAGG + Intergenic
1025244012 7:57302470-57302492 CTGTATTTAAATCCAGAAGTAGG - Intergenic
1026119284 7:67522650-67522672 CTTTCTGTGAAAACAGAAGAAGG + Intergenic
1028110007 7:86929107-86929129 CTGTATATGAATGCAGACACTGG - Intronic
1028591103 7:92496261-92496283 CTGTATATGAATACAGAAGATGG - Intronic
1028977095 7:96926386-96926408 CTGCATATTAATAGAGAAGCAGG + Intergenic
1029209069 7:98890698-98890720 GTGCAAATGTATACAGAAGAAGG + Intronic
1031503762 7:122555193-122555215 CTGTAGATCAATACCAAAGAAGG + Intronic
1033071904 7:138210549-138210571 CAGTATAAGAAAACAGAAAATGG + Intergenic
1033915332 7:146317099-146317121 ATGTATATGAATAAATAAAAAGG - Intronic
1036662825 8:10718912-10718934 CTGTATGTGAATGCATAGGAGGG - Intergenic
1037037896 8:14190548-14190570 TTGGATATGTACACAGAAGAGGG + Intronic
1037297628 8:17417744-17417766 CCGTCTATGAATCCAGAAGCAGG + Intergenic
1038774068 8:30512320-30512342 CTGTATAAAAATACAGCATATGG + Intronic
1039413403 8:37374385-37374407 GTGTATTTTAATACTGAAGAGGG + Intergenic
1041677617 8:60551206-60551228 GTGTACATGTATACAGAAGAGGG - Intronic
1041962177 8:63630883-63630905 CTGTAGAAGAATACATCAGATGG - Intergenic
1043271953 8:78345100-78345122 CTGTATATGAATTAGGAAGCAGG + Intergenic
1043666999 8:82826711-82826733 CTGAGTCTGAAGACAGAAGAAGG + Intergenic
1044647935 8:94464306-94464328 CTGGCTATGAAGACGGAAGAAGG + Intronic
1045910797 8:107407355-107407377 CTGTATGTAAATACCGAGGATGG + Intronic
1048188471 8:132265863-132265885 ATTTAAATGAAGACAGAAGATGG - Intronic
1049913102 9:289192-289214 CTGTATTCGAATACAAAACAAGG - Intronic
1050359911 9:4820109-4820131 CTGTTTATGAATACATAATTAGG - Intronic
1050907108 9:11018188-11018210 CTGTTTATAAATATAGAAAAAGG - Intergenic
1053092968 9:35296725-35296747 GTGTATATGAATACATATTAGGG - Intronic
1053884412 9:42632084-42632106 CTGTAGATATATACAGAACAGGG - Intergenic
1053888256 9:42662210-42662232 CTGTAGATATATACAGAACAGGG + Intergenic
1054223436 9:62439531-62439553 CTGTAGATATATACAGAACAGGG - Intergenic
1054227275 9:62469656-62469678 CTGTAGATATATACAGAACAGGG + Intergenic
1055270334 9:74550649-74550671 CTGTATAAGAAAAGAGAAAATGG - Intronic
1055573068 9:77636283-77636305 CTGATCATCAATACAGAAGATGG + Intronic
1057205983 9:93173037-93173059 CTCCATGTGAATATAGAAGAGGG - Intergenic
1059741693 9:117157237-117157259 CTGTATTTGAACACAGAGGAGGG + Intronic
1185921725 X:4100511-4100533 CTGTATAGTAAAACAGAAAAGGG - Intergenic
1186095259 X:6094399-6094421 GTGCATATGAATAGAGAAGCTGG - Intronic
1186212691 X:7266605-7266627 CTGTATAGTAATTCAGGAGATGG + Intronic
1186248468 X:7640212-7640234 CTGTGTATGAAGAGAGTAGAGGG + Intergenic
1186831099 X:13390855-13390877 CTGGCTGTGAAGACAGAAGAAGG - Intergenic
1187417094 X:19102795-19102817 CTGTCTATAAACCCAGAAGAGGG + Intronic
1187549666 X:20289409-20289431 CTCTACATGAATACTGTAGATGG + Intergenic
1189048350 X:37617501-37617523 CTTGATAAGAATGCAGAAGAGGG - Intronic
1189090208 X:38074186-38074208 CAGTAAATGAATACAGAATATGG + Intronic
1190834442 X:54087359-54087381 CTGTGTTTGGAAACAGAAGAGGG - Intronic
1192962051 X:76141659-76141681 CTGGATATAAATAAATAAGAAGG + Intergenic
1193073744 X:77333379-77333401 CTGTATAGGCATGCAGAAGCTGG - Intergenic
1193552292 X:82910637-82910659 CTGGAAATAAATACAGAGGACGG + Intergenic
1193597054 X:83459628-83459650 CTGTATGTGGAAACAAAAGAAGG - Intergenic
1195036863 X:100978002-100978024 CTGTGTATGTATCCAAAAGAAGG - Intronic
1195556324 X:106228879-106228901 TTGGATATGTATACAGAAGTGGG + Intergenic
1196251091 X:113460778-113460800 CCATCTATGAATAAAGAAGAGGG - Intergenic
1196555134 X:117076995-117077017 GTGTACAGGAATACAGAAAAGGG + Intergenic
1197167480 X:123393812-123393834 CTGTTTATGAATAGAAATGATGG + Intronic
1197828811 X:130619668-130619690 CTGTATCAGAAGACAGTAGAAGG + Intergenic
1197986464 X:132270959-132270981 ATGACTATGAATACAGAGGAAGG + Intergenic
1198253598 X:134905616-134905638 CTGTTTTTGAAAACACAAGAGGG + Intronic
1199318908 X:146415099-146415121 CTGTCTTTGAAGATAGAAGAAGG + Intergenic
1201251516 Y:12063191-12063213 CTGTCTGTGAATAAAGAAGCTGG - Intergenic