ID: 1028602018

View in Genome Browser
Species Human (GRCh38)
Location 7:92611958-92611980
Sequence TGTCCCTCCTTTGAAGTGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028602018_1028602023 1 Left 1028602018 7:92611958-92611980 CCATCCACTTCAAAGGAGGGACA 0: 1
1: 0
2: 0
3: 21
4: 149
Right 1028602023 7:92611982-92612004 AGTGGGAGGCTCCAACCCACTGG 0: 1
1: 0
2: 2
3: 15
4: 184
1028602018_1028602024 2 Left 1028602018 7:92611958-92611980 CCATCCACTTCAAAGGAGGGACA 0: 1
1: 0
2: 0
3: 21
4: 149
Right 1028602024 7:92611983-92612005 GTGGGAGGCTCCAACCCACTGGG 0: 1
1: 0
2: 0
3: 12
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028602018 Original CRISPR TGTCCCTCCTTTGAAGTGGA TGG (reversed) Exonic
900659998 1:3777505-3777527 TTTCCCTCCTTGGGAGTGGCAGG - Intergenic
901681226 1:10914021-10914043 TGGTCCTCCTTTCCAGTGGAGGG - Intergenic
901951938 1:12756329-12756351 TGCCCCTCCTTGGGTGTGGAGGG - Intronic
902755381 1:18545947-18545969 TGTCCCTCCTTTCCAGTTGAGGG + Intergenic
905900521 1:41579144-41579166 TATCCCTCCTTACCAGTGGATGG - Intronic
906662349 1:47592282-47592304 TTTTCTTCCTTTGAAGTGGGCGG + Intergenic
908550262 1:65201720-65201742 TGACCCTCTTTTGAAGGTGAGGG + Intronic
910632225 1:89367821-89367843 GTTCTCTCCCTTGAAGTGGAGGG - Intronic
912849147 1:113106351-113106373 TTTCCCTGCTTCTAAGTGGATGG + Intronic
919974063 1:202599496-202599518 TTTGCCACCTTTGAACTGGATGG - Intronic
922853388 1:228753901-228753923 TGTTCCTACTCTGAAGAGGAAGG - Intergenic
924154755 1:241164356-241164378 TTCCCCTCCTTGGAAGTTGAGGG + Intronic
1062832315 10:614072-614094 TGTGCCTGTTTTGAGGTGGAAGG - Intronic
1062905561 10:1177223-1177245 TGTCCCTTCTTTGGGGTGGGTGG + Intergenic
1066224376 10:33368139-33368161 TGTGGCTCCTTTGAACCGGAAGG + Intergenic
1067514526 10:46926522-46926544 TTTCTCTCCTAGGAAGTGGAAGG + Intronic
1067647734 10:48125291-48125313 TTTCTCTCCTAGGAAGTGGAAGG - Intergenic
1068557703 10:58477464-58477486 TCTGCATCCTTTGAAGTTGAGGG + Intergenic
1070062867 10:73002083-73002105 TTTCCCTCCCTTGAACGGGAGGG - Intergenic
1071768871 10:88702096-88702118 TGTTCCTCCTATAAAATGGAAGG - Intergenic
1073868834 10:107837733-107837755 TCTCACTCCTTTGAAGAGGATGG + Intergenic
1074223827 10:111463809-111463831 CGTCTCTCCTTTGAAGTGGCTGG + Intergenic
1074862151 10:117518569-117518591 TTTCCCTCCTTTGAAGTCTCTGG + Intergenic
1075299030 10:121304056-121304078 TTTCCCGGCTTTGAAGTAGAAGG - Intergenic
1076148346 10:128143100-128143122 TGTCTCACCTCTGAAGAGGATGG + Intergenic
1077327231 11:1969116-1969138 GCTCCCTCCTTTGTAGCGGAAGG - Intronic
1078574607 11:12488845-12488867 TGTCCTTCTTTTAAAGAGGAAGG + Intronic
1079953545 11:26834177-26834199 TTGCCCTCCATTAAAGTGGATGG - Intergenic
1080624662 11:34017459-34017481 TGTCCTACCCTTGAAGTGCATGG - Intergenic
1081759733 11:45568806-45568828 TTGCCATCCTTTGAAGGGGAAGG - Intergenic
1087329134 11:96757338-96757360 TGGTCTTCATTTGAAGTGGATGG + Intergenic
1089126698 11:116181257-116181279 TGTCTCTCCTTGGAACTGCATGG - Intergenic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1202810213 11_KI270721v1_random:24296-24318 GCTCCCTCCTTTGTAGCGGAAGG - Intergenic
1093140866 12:15508956-15508978 TGACCCTCCTCTGAAGAGAAAGG - Intronic
1097158824 12:57031248-57031270 ACTTCCTCCTTTGAAGTGGCAGG - Intronic
1097990163 12:65825301-65825323 TGTCCCTGGGCTGAAGTGGACGG - Exonic
1098769556 12:74536374-74536396 TGTCTCTCCTTTAATCTGGAAGG + Intergenic
1100125495 12:91419871-91419893 TCACCCTCCTTTCAGGTGGAGGG + Intergenic
1101618663 12:106362269-106362291 GGTCCTTCCTTTGAAGTGGGAGG + Intronic
1102489107 12:113278216-113278238 AGTTGCTGCTTTGAAGTGGAAGG + Exonic
1102490568 12:113287645-113287667 TGTCCCGCCTTGGGAGAGGATGG - Intronic
1103241178 12:119414455-119414477 TTCCCATCCTTTGAACTGGAAGG - Intronic
1103941692 12:124504803-124504825 TGCCCCTCCTGTGAAGTTAATGG - Intronic
1104175411 12:126326593-126326615 TGTCTCACCTGGGAAGTGGAAGG - Intergenic
1106260679 13:28063868-28063890 TCTCCCTCCTTTGAAGTTCCAGG - Intronic
1112356210 13:98676599-98676621 TGTCCCTGCTTTGCAGTGGCTGG - Intergenic
1115472113 14:33778823-33778845 TGTCTCTCCTATAAAGTGGTGGG + Intronic
1120654304 14:87170427-87170449 AGTCCCTCCTTTGACGTGTAGGG + Intergenic
1123410868 15:20057858-20057880 TATCTCTCCTTTCAATTGGAGGG - Intergenic
1123520199 15:21064563-21064585 TATCTCTCCTTTCAATTGGAGGG - Intergenic
1124687020 15:31791465-31791487 TGTCCCTCTTTTGAGTAGGAGGG + Intronic
1125816028 15:42585188-42585210 TGTCCCTTCTTTGAAATGCTTGG - Intronic
1129814862 15:78542798-78542820 TGTTACTCCTTTTAAGTGCAGGG + Intronic
1129956684 15:79643529-79643551 TGTCCCTGGTTTCATGTGGAAGG - Intergenic
1135488210 16:22884584-22884606 TTTGCCACCTTTGAACTGGATGG + Intronic
1135845198 16:25912442-25912464 TGTCACTCCTTCGAGGAGGAAGG + Intronic
1142628751 17:1209666-1209688 TGCACCTGCTTTGAAGTGGGTGG + Intronic
1144120409 17:12147207-12147229 GGTCCCTAATTAGAAGTGGAAGG - Intergenic
1148170004 17:45511174-45511196 AGTCCTTCCTCTGAAGTGGCAGG + Intergenic
1148217682 17:45842443-45842465 TGTGGATTCTTTGAAGTGGAGGG - Intergenic
1148279204 17:46334642-46334664 AGTCCTTCCTCTGAAGTGGCAGG - Intronic
1148301421 17:46552495-46552517 AGTCCTTCCTCTGAAGTGGCAGG - Intronic
1149364174 17:55924171-55924193 TTTTCCTCCTCTGAAATGGAGGG - Intergenic
1149979534 17:61298764-61298786 TGTGACTACTTTGAACTGGAAGG - Intronic
1150401086 17:64856770-64856792 AGTCCTTCCTCTGAAGTGGCAGG + Intronic
1152878067 17:82799616-82799638 TGTCCCTCCTGTGCGGTGCAGGG - Intronic
1155067266 18:22278847-22278869 TGTCCCCACTTTGAAGATGAGGG + Intergenic
1155353530 18:24929244-24929266 TGGCCCTCCTCAGAGGTGGATGG - Intergenic
1161229020 19:3163229-3163251 TTTCCCTCCTTTGAAAGGGAAGG + Exonic
1161838792 19:6665962-6665984 TATCCCTGCTTTGCAGAGGAGGG + Intronic
1166130208 19:40741526-40741548 TGTTCCTCCTTCAGAGTGGAGGG + Exonic
926556911 2:14368577-14368599 TCTCCCTCCTTGAAAGTGGGTGG + Intergenic
927105632 2:19821278-19821300 TGTTCCACCTTTCAGGTGGATGG - Intergenic
928276033 2:29900771-29900793 TGTCTCTCTCTTGAGGTGGAGGG - Intronic
938343246 2:130549183-130549205 TGTCCCTCCTGTGAAGTGAGAGG - Intronic
938346587 2:130571539-130571561 TGTCCCTCCTGTGAAGTGAGAGG + Intronic
941873500 2:170410011-170410033 TGTCCCTCTCGTGAAGGGGAAGG + Intronic
942686308 2:178535981-178536003 ACTGCCTCCTTGGAAGTGGAAGG - Exonic
942799939 2:179862917-179862939 TGTCCCAACTCTGAAGTGCATGG - Intergenic
946571170 2:221025765-221025787 TGTCCCTCCTCTGACGTGTGGGG + Intergenic
946724822 2:222652029-222652051 TTCCGCCCCTTTGAAGTGGAAGG + Intronic
947418014 2:229918405-229918427 TTTCCCCCCTTTTAAGTGGATGG - Intronic
1168859484 20:1035711-1035733 TTTCCCTCCTTTGTAGTTCAGGG + Intergenic
1172671061 20:36634712-36634734 TGGCCCTCTTAGGAAGTGGATGG - Intronic
1173194816 20:40905544-40905566 TCTCCCTCCTGTGATGTGGGTGG - Intergenic
1173200666 20:40952554-40952576 TGTAGCTCCTTTGAATTGCAGGG - Intergenic
1173759466 20:45547041-45547063 TTCAGCTCCTTTGAAGTGGAGGG - Intronic
1174497274 20:50956825-50956847 TGTAGCTGCTTTGAAGTGGTAGG - Intronic
1175914686 20:62420095-62420117 TGTCCCTCCATTGAGGTGCCAGG - Intronic
1177849788 21:26332858-26332880 TTTTCCTCTTTTCAAGTGGAAGG - Intergenic
1181589184 22:23872714-23872736 TGTCCCTCCTTCTTAGAGGAAGG + Intronic
1182345375 22:29660113-29660135 TAGCCCTCATTTGGAGTGGAAGG - Intronic
950141437 3:10618904-10618926 TGTCACTCCTTGGAAGAGGATGG - Intronic
950758298 3:15196580-15196602 TGTCCCTTCTTTTAAGCGGTAGG - Intergenic
951802313 3:26609762-26609784 ACTCCCAACTTTGAAGTGGAAGG + Intergenic
952045975 3:29320760-29320782 TGGCCCTTTTTTGAAGTGGAGGG + Intronic
953144534 3:40262110-40262132 AGTCCCTACTTTTGAGTGGAGGG - Intergenic
953533272 3:43757000-43757022 TTTACCTGCTCTGAAGTGGAAGG + Intergenic
953676320 3:45005777-45005799 TGTCCCCCCTATGAAATGGGAGG + Intronic
956669454 3:71672654-71672676 AGCCCGGCCTTTGAAGTGGAAGG + Intergenic
956695307 3:71913811-71913833 TGTCCCTGCTTTGAAATCGAGGG - Intergenic
960055123 3:113271479-113271501 TGTCACTCCTTTGAATTGGCAGG - Intronic
960606951 3:119515918-119515940 TCTACCTCCTTTGAAGGAGAAGG + Intronic
968966178 4:3770094-3770116 TGCCCCACCTGGGAAGTGGAGGG + Intergenic
972776995 4:42250547-42250569 TTTCCCTCCTTTGATGATGAAGG - Intergenic
974223426 4:59006285-59006307 TGTCTCTCATTTGAGATGGATGG - Intergenic
975635024 4:76439647-76439669 TGACCCTCCATTGTAGGGGAAGG + Intronic
981000357 4:139823323-139823345 GGTCCTGCCTTTGAGGTGGAGGG - Intronic
981425033 4:144593446-144593468 TGCCTCTCCTTTGCAGTGGAAGG + Intergenic
982838011 4:160147163-160147185 TGTTCCTCCCTTGAAGAGGTGGG + Intergenic
984944220 4:184958626-184958648 TATCCCTCCTTTAAGGGGGAAGG - Intergenic
987073806 5:14361746-14361768 TGTCACTCCACTGAAGTGGGTGG + Intronic
988931357 5:36038685-36038707 TGTCTCTTCTTTGAAATGGGAGG + Intronic
992153080 5:73925625-73925647 AGTCGCTGCTTTGAAGGGGAGGG - Intronic
995327173 5:110903988-110904010 TGACCTTCCTTAGAAGTGAAAGG - Intergenic
996038731 5:118787243-118787265 TTTTACTCCTCTGAAGTGGAGGG + Intergenic
997863607 5:137442015-137442037 TTTGCCTCTTTAGAAGTGGAAGG - Intronic
997866892 5:137471808-137471830 TTTCCCTGCTGAGAAGTGGAGGG - Intronic
999099766 5:149013692-149013714 GGTCCCTCCATTGACATGGAGGG - Intronic
1004821186 6:19369554-19369576 TGTCTTTCCTTTAAAGTGAAGGG - Intergenic
1005737693 6:28764169-28764191 TCTCCCTCCGTTGAAGTGGGAGG - Intergenic
1007231166 6:40348590-40348612 TGAACCCCCTTTGACGTGGAAGG + Intergenic
1009969882 6:70615109-70615131 TGGACCACCTCTGAAGTGGAGGG + Intergenic
1011693184 6:89888126-89888148 TCTCCCTCCTTGGAATAGGAGGG - Intergenic
1011727723 6:90227541-90227563 TGCCTCTCTTTTGAAATGGAGGG - Intronic
1012127526 6:95449590-95449612 TGTTCCCACTTTTAAGTGGAAGG + Intergenic
1015564834 6:134558615-134558637 TGTCCCTCCTACGACGTGCAGGG - Intergenic
1015975834 6:138789912-138789934 TGGCCCTACTTGGAAGTGGGTGG + Intronic
1016432112 6:143996770-143996792 TTTCCCTCCATTGAATTGCATGG - Intronic
1016866944 6:148776952-148776974 TGTCCCTGCTCTCAAGTGGCTGG + Intronic
1018479252 6:164173636-164173658 TGTCCTTCCATGAAAGTGGACGG - Intergenic
1018749063 6:166786672-166786694 TTTTCCTCCTGTGATGTGGAAGG - Intronic
1019603275 7:1895870-1895892 TGTCCCTTCTTTCCAGTGGCAGG - Intronic
1020605011 7:10326413-10326435 TGTCCCTCCATTATAGAGGAGGG + Intergenic
1020910319 7:14121122-14121144 TTTCCCTCCTTGGAAGTCTATGG - Intergenic
1022199921 7:28106626-28106648 TGCATCTCCTTTGCAGTGGAGGG - Intronic
1024178656 7:46865521-46865543 TGTCCCAAATTTGGAGTGGAGGG + Intergenic
1025849880 7:65237049-65237071 TGTGCCTCCTTTGGAGGGTAGGG - Intergenic
1026962076 7:74415311-74415333 TATCCCTCCCTGGCAGTGGATGG - Intergenic
1028602018 7:92611958-92611980 TGTCCCTCCTTTGAAGTGGATGG - Exonic
1030866315 7:114705221-114705243 GGTCCCTCCTTTGACATGTAGGG - Intergenic
1033016974 7:137681187-137681209 TGTCCACCCTTTGATGTAGAGGG - Intronic
1037643662 8:20771157-20771179 TGGCCCTCCTTTGCAGTGGGTGG + Intergenic
1037834182 8:22206725-22206747 TGTCCCACTTATGAACTGGATGG - Intronic
1038646280 8:29365180-29365202 TGACCCTCCTTTGCTGTAGAAGG + Intergenic
1039863912 8:41484316-41484338 TGTACCTCCCTTGAGTTGGAGGG - Intergenic
1043604478 8:81983400-81983422 TGTTCCTGCTGTGAAGAGGATGG - Intergenic
1044727206 8:95203455-95203477 TGGCCCTCCTTTAAAGTGCCGGG + Intergenic
1045426973 8:102077116-102077138 TGTCTCTCCTTTGCAGAGGCTGG + Intronic
1046491211 8:114954409-114954431 TGTCCCTCCTGTGAAATGTGGGG + Intergenic
1048318249 8:133377641-133377663 TGTCCCTCTCTTAAAGTGAATGG - Intergenic
1049311399 8:141935726-141935748 TGTCCCTCCCTCCACGTGGAAGG + Intergenic
1049757597 8:144317706-144317728 GTGCCCTCCTTTGCAGTGGATGG - Exonic
1053039987 9:34862396-34862418 TCTCTCTCCTCTCAAGTGGAAGG - Intergenic
1054701752 9:68419784-68419806 TGTGCCTCTTTTGCAGTGGATGG + Intronic
1056507692 9:87272956-87272978 TGACCCTCCTTGAAGGTGGAGGG + Intergenic
1058309855 9:103486303-103486325 GGTCCCTCCTTTGACATGTAGGG - Intergenic
1059142850 9:111870472-111870494 AGCCCCTCCTTAGAAATGGAGGG - Intergenic
1059143966 9:111880456-111880478 TTTCCATACTTTGAAGTAGATGG + Intergenic
1060254015 9:122010583-122010605 TGTCCCTCCATTGCAGAGGATGG - Intronic
1061059862 9:128244974-128244996 TCTGCCTCCTTTGACGTGGCAGG + Intronic
1061585740 9:131567254-131567276 TGTGGCTCCTTTGAAGGTGATGG + Intergenic
1189182392 X:39016540-39016562 TCTCCCTGCTTTGAAGTGCTGGG - Intergenic
1190067287 X:47250111-47250133 GTTCCCTCCCTTGAACTGGAGGG - Intergenic
1195833804 X:109089527-109089549 TGTCTCACCTGTGAAGTGCAAGG - Intergenic
1195997750 X:110748058-110748080 TCTCCCCCTTTGGAAGTGGAAGG + Intronic
1197571065 X:128151242-128151264 AGTCCCTCCTTTCAACTGGTTGG - Intergenic
1198106786 X:133469740-133469762 TGTTCCTCCTCTGAAGTTGAAGG + Intergenic
1199522169 X:148748618-148748640 TATCCATCCTTTGCAGAGGATGG + Intronic
1201294337 Y:12450794-12450816 TATTGCTCCTTTGAAGTGGACGG + Intergenic