ID: 1028605953

View in Genome Browser
Species Human (GRCh38)
Location 7:92656060-92656082
Sequence TTTCCTATGGTTAAAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028605947_1028605953 20 Left 1028605947 7:92656017-92656039 CCAGAGAAGGTTAAAGGCGAAAG 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1028605953 7:92656060-92656082 TTTCCTATGGTTAAAGTGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 175
1028605949_1028605953 -4 Left 1028605949 7:92656041-92656063 CCATGCGGAATGCTCTATATTTC 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1028605953 7:92656060-92656082 TTTCCTATGGTTAAAGTGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028605953 Original CRISPR TTTCCTATGGTTAAAGTGGG AGG Intronic
900811417 1:4804243-4804265 TCTCCTATGGTTGCAGTGGATGG + Intergenic
902137646 1:14324128-14324150 TCACCTGTGGTTACAGTGGGAGG - Intergenic
902405053 1:16177978-16178000 TTCCCTATCTGTAAAGTGGGTGG - Intergenic
902777672 1:18685000-18685022 TTTCCTCTGGCAAAAGAGGGAGG + Intronic
905937422 1:41835918-41835940 TTTCTTTTGGTGAAAGTGTGAGG - Intronic
906557247 1:46723642-46723664 TTTGCTATGGCTGAGGTGGGGGG + Intergenic
913011665 1:114689447-114689469 TTTCCCATTCTTAAAATGGGGGG + Intronic
915859079 1:159422781-159422803 TTTCCTATGGCTAGAGTTGTAGG + Intergenic
916895035 1:169153398-169153420 GTTCCTCTGGTTGAAGTGGAGGG - Intronic
919431460 1:197497223-197497245 TTTCCTGTTGTTATAGTGGTAGG - Intergenic
920599222 1:207305733-207305755 TTCCCCATGGATAAAGTAGGGGG - Intergenic
924956464 1:248933024-248933046 TTTCTTACTGTTGAAGTGGGAGG - Intergenic
1063076880 10:2725805-2725827 TTTCCAATGGTTTAAGTCAGTGG - Intergenic
1063668575 10:8081508-8081530 TTTCCTATGCATAAAATGAGGGG - Intergenic
1064381649 10:14847371-14847393 TTTCCTATTCTTAAAGTGTTTGG + Intronic
1067030923 10:42878535-42878557 CCTCCTATGGATAAAGTCGGTGG + Intergenic
1067351523 10:45480555-45480577 TATCCTTTGGTTAGAGTGGCTGG - Intronic
1069756679 10:70777861-70777883 TTTCTTATCTTTAAAATGGGGGG - Intronic
1073539301 10:104305477-104305499 TTTCCAAGGGTTAAAATGTGAGG + Intergenic
1076962267 10:133773911-133773933 TTTCTTACTGTTGAAGTGGGAGG - Intergenic
1081542241 11:44044241-44044263 CTTCCTAGGGCTAAAATGGGAGG + Intergenic
1082268752 11:50146733-50146755 TTCCCCATCTTTAAAGTGGGGGG - Intergenic
1087149950 11:94850336-94850358 TTGGCTCTGGTTAAAGTAGGTGG - Intronic
1087477310 11:98652257-98652279 TTTTCTAGGATTAAAGTGGAAGG + Intergenic
1091208658 11:133837654-133837676 TTTCCTAAGGTCAATGAGGGGGG + Intergenic
1097856303 12:64466885-64466907 TTTTATATTGTTGAAGTGGGTGG + Exonic
1101489656 12:105199214-105199236 TTTCCTGTGTTGCAAGTGGGAGG + Intronic
1102379001 12:112447294-112447316 TTTCCTCTGGGGAAAGAGGGAGG - Intronic
1102525200 12:113507642-113507664 TTTTCTATCTGTAAAGTGGGAGG + Intergenic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1107730811 13:43346423-43346445 TCTCCTCTGGTTAAAGTGTGAGG - Intronic
1107838016 13:44427865-44427887 TTTCCTATGCTTCCAATGGGAGG - Intergenic
1108213984 13:48165578-48165600 TTTCCTATGTTTAAGGTAGTTGG + Intergenic
1110296480 13:73872253-73872275 TTACCCAGGGTGAAAGTGGGTGG - Intronic
1111993282 13:95137968-95137990 TTTTCTTTGGGGAAAGTGGGCGG + Intronic
1113226495 13:108165399-108165421 TTTTCTGTGATAAAAGTGGGAGG + Intergenic
1115661403 14:35498281-35498303 TTTCCAATGCTGAAAGTTGGGGG - Intergenic
1115891832 14:38039224-38039246 TTCCCTATGGTTCAATTGTGTGG - Intronic
1117136105 14:52735452-52735474 GTTCCTATGGTTTTGGTGGGAGG - Intronic
1118366031 14:65096903-65096925 CATCCTATGGTTACAGTGGCTGG + Intronic
1125761657 15:42100310-42100332 TTTCCTGGGGTTAAAGTAGGTGG - Intergenic
1127238881 15:57088566-57088588 TTTAATATGGTTTCAGTGGGGGG + Intronic
1128807250 15:70540180-70540202 ATTCCTATGGCTGCAGTGGGAGG - Intergenic
1129771298 15:78204998-78205020 TTTCCTAGGGAGAAAGCGGGTGG + Intronic
1132370095 15:101290682-101290704 ATTCCAGTGGCTAAAGTGGGAGG - Intronic
1134387315 16:13785798-13785820 TTTCTTATGGGTATTGTGGGAGG + Intergenic
1135801727 16:25503602-25503624 TTTCATGTAGTTAAAGTGTGTGG + Intergenic
1137917103 16:52443943-52443965 TGTCCTCTGTTTAAACTGGGAGG - Intronic
1139397455 16:66651610-66651632 TTTCCCATGGTGAAAGGGGTGGG - Intronic
1141413830 16:83854800-83854822 TTTCCTATTGTCACAGTGGCCGG + Intergenic
1141777800 16:86135854-86135876 TTTCCTGTGTGCAAAGTGGGCGG - Intergenic
1142885024 17:2907229-2907251 GTTCTTATGGTTTAGGTGGGCGG - Intronic
1143857153 17:9860437-9860459 TTTCCTATGGTTCTGGAGGGTGG + Intronic
1144194397 17:12876284-12876306 TTTCCTGTGGTTTTCGTGGGAGG - Intronic
1144415247 17:15040395-15040417 ATTCCTAAAGTTAAACTGGGAGG + Intergenic
1147689595 17:42307230-42307252 TTTCCTAGGGTACAAGTTGGGGG + Intronic
1152951380 17:83235577-83235599 TTTCTTACTGTTGAAGTGGGAGG - Intergenic
1153679384 18:7485721-7485743 TATCCTCTGTTCAAAGTGGGTGG - Intergenic
1154062261 18:11073072-11073094 TTTCCTATGATTAACTTCGGAGG + Intronic
1154399729 18:14025252-14025274 TTTCCTGTGGCAACAGTGGGAGG + Intergenic
1155397076 18:25397966-25397988 TTTCCTGTGCTTGAGGTGGGAGG - Intergenic
1157507374 18:48238160-48238182 GTTCCTTTTCTTAAAGTGGGTGG + Intronic
1158054865 18:53266686-53266708 TTACCTATGGCTGAAGTGTGAGG - Intronic
1158660946 18:59386965-59386987 TTTCCAATGATTAAAGTAGTGGG + Intergenic
1159092908 18:63869784-63869806 GATCCTATGGTTAAAGGAGGAGG + Intergenic
1166816084 19:45547065-45547087 TTTCCTATGGGGAAGGAGGGAGG + Intronic
1168727409 19:58594615-58594637 TTTCTTACTGTTGAAGTGGGAGG - Intergenic
927234537 2:20858482-20858504 ATTCCAATGGTAAAAGTGAGAGG + Intergenic
929383652 2:41380814-41380836 ATACCTGTGGTTAAGGTGGGGGG - Intergenic
929393645 2:41498201-41498223 TTTCCTAGGGTTAATTTGGTTGG - Intergenic
931146153 2:59521140-59521162 CTTCATATGGTTTCAGTGGGAGG - Intergenic
932277549 2:70462875-70462897 TTTCCTATGGGCCAAGTGCGGGG - Intronic
932594417 2:73085369-73085391 AGTCCTATGGTTAGTGTGGGGGG + Intronic
936571141 2:113616579-113616601 TTTCTTACTGTTGAAGTGGGAGG + Intergenic
938529025 2:132164058-132164080 TTTCTCATTATTAAAGTGGGAGG - Intronic
939241744 2:139570099-139570121 TTTCATATGGTTCAAGAGAGAGG - Intergenic
939702972 2:145417315-145417337 TTTCCTTTTCATAAAGTGGGGGG + Intergenic
941653159 2:168115374-168115396 TTACATATGTTTAAAGTGGGAGG - Intronic
944258787 2:197653761-197653783 TTTCTTATGGAAAAAGTGGATGG - Intronic
946699898 2:222401911-222401933 TTTACTATACTTAAAGTTGGAGG - Intergenic
946817731 2:223596124-223596146 TTTCCTATTGTAAAAGGGAGGGG + Intergenic
1168860807 20:1044785-1044807 TTTGCTAGGGTTAAACTGTGAGG - Intergenic
1171432819 20:25095435-25095457 TATCCAATGTTGAAAGTGGGGGG - Intergenic
1172646332 20:36472541-36472563 TTTCCTATTGATAAAATAGGAGG - Intronic
1174125017 20:48297922-48297944 ATGCCCATGGCTAAAGTGGGTGG - Intergenic
1174200685 20:48804566-48804588 TTTCCTCTGGGTGAGGTGGGAGG + Intronic
1175218079 20:57401882-57401904 TTTCTTCTGGGTACAGTGGGAGG + Intronic
1176246722 20:64100938-64100960 TTTCCTGAGGATACAGTGGGAGG + Intergenic
1177637348 21:23804439-23804461 ATTGCTCTGGTTAAAGTGTGTGG + Intergenic
1178328973 21:31670390-31670412 TTTCTTTTGCTTAAAGTTGGTGG - Intergenic
1178630434 21:34255108-34255130 TTTCTTAATGTTAGAGTGGGAGG - Intergenic
1179026710 21:37684628-37684650 TTTTCTTTTGCTAAAGTGGGTGG + Intronic
1180262849 21:46686417-46686439 TTTCTTACTGTTGAAGTGGGAGG - Intergenic
1183481120 22:38066106-38066128 TGTCCTATGGCTAAAGGGGCTGG - Intronic
1184489781 22:44801834-44801856 TTTTCTATCTGTAAAGTGGGGGG + Intronic
1184579007 22:45399945-45399967 TTTCCCATTGTTGAAGTGGGAGG + Intronic
1185429050 22:50794291-50794313 TTTCTTACTGTTGAAGTGGGAGG - Intergenic
949206798 3:1449756-1449778 TTTCCTATATTTAAAATAGGGGG + Intergenic
950916359 3:16649890-16649912 TTGCCTTTGGTAAAAATGGGAGG + Intronic
951150039 3:19277981-19278003 TCTCTTAGGGTTAAGGTGGGAGG - Intronic
953583894 3:44182299-44182321 TGGCCTATGAGTAAAGTGGGTGG - Intergenic
953804942 3:46060673-46060695 TTACCTATGGTAATAGTGAGTGG + Intergenic
953807048 3:46079582-46079604 TTTCCTAAGGTGGTAGTGGGAGG - Intergenic
955783894 3:62515698-62515720 TTTCCTCTGTTTAAAGAAGGGGG + Intronic
956587000 3:70875596-70875618 TTTGCTGTAGTTAAAATGGGAGG - Intergenic
957189108 3:76983757-76983779 TTCCTCATGGTAAAAGTGGGAGG - Intronic
961182792 3:124889120-124889142 TTTCCTGTGGGTAAATTGTGAGG - Intronic
962817214 3:139012252-139012274 TGTCCTATGCTGAAAGTGGGGGG + Intronic
963323886 3:143839948-143839970 TCTCCTATGGTGAAAGGGGGAGG - Intronic
968327802 3:197835548-197835570 TTTTCTATTTTGAAAGTGGGAGG - Intronic
970129932 4:12857361-12857383 TTTCCTTTGGGTAAAGAGGAAGG - Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
973049464 4:45576980-45577002 TTTCATATTGCTAGAGTGGGAGG + Intergenic
973748725 4:53990382-53990404 TTTCCTCAGGTTAAAGTCGTGGG + Intronic
973843803 4:54890650-54890672 GTTCCTAAGGATGAAGTGGGTGG - Intergenic
975980241 4:80149145-80149167 TTTTTCATGTTTAAAGTGGGAGG - Intergenic
976454806 4:85234019-85234041 TTTCCTATGGGCCAAGTGGATGG + Intergenic
977668332 4:99667172-99667194 TTTCTTATCTTTAAAGTGAGTGG - Intergenic
977691825 4:99919867-99919889 ATTTCTATGGTTAAAGAGAGGGG - Intronic
980432553 4:132722993-132723015 TTTTATATGGTTAAAGTTTGGGG + Intergenic
982233293 4:153228970-153228992 TTTCCTGTTGTTTTAGTGGGTGG - Intronic
985465499 4:190191391-190191413 TTTCTTACTGTTGAAGTGGGAGG - Intergenic
986904738 5:12482367-12482389 TTACTACTGGTTAAAGTGGGAGG + Intergenic
987615552 5:20269366-20269388 TTTCCTTTGGGAAAAGTGGTGGG - Intronic
989611582 5:43298699-43298721 TTTCCTATGATTGCATTGGGCGG - Exonic
993522804 5:88924789-88924811 TTTCTTATGGTTAATGTGTTTGG - Intergenic
995757821 5:115528474-115528496 CTCCCTAGGGTTAAAGTTGGAGG - Intronic
996799283 5:127385192-127385214 TTTCCTATGTTTAAAGTCCATGG + Intronic
1000187138 5:158870134-158870156 TTGCCTTTGGTTGAAGTGGAGGG - Intronic
1000665308 5:163987782-163987804 TTTCCTACGTGTAAAGTGAGTGG + Intergenic
1000686783 5:164259572-164259594 TTTCCTTTGTTTACAGTGAGAGG + Intergenic
1000734669 5:164884369-164884391 TTTCCTATGCTTAATGGGGTAGG + Intergenic
1000758240 5:165187272-165187294 TTTGCTATCTTAAAAGTGGGTGG - Intergenic
1003848511 6:10198383-10198405 TTTCAAATGGAGAAAGTGGGTGG - Intronic
1004663151 6:17727995-17728017 GTTCCTAGGGTTTGAGTGGGAGG + Intergenic
1004803321 6:19174906-19174928 TTTCCCATGGTCAGAGTAGGTGG + Intergenic
1005608655 6:27501685-27501707 TTTCTTATTGTAAAAGTGGGTGG + Intergenic
1008022317 6:46593861-46593883 TTTTCTATGGACAAAGTAGGAGG - Intronic
1008395208 6:50998281-50998303 TTCCTTATGGATAAGGTGGGTGG - Intergenic
1009327264 6:62367885-62367907 TATACTATGTTTAAAGTGGTCGG - Intergenic
1009445039 6:63732719-63732741 TTGCCTATGGTGAAATAGGGAGG - Intronic
1010706294 6:79115487-79115509 TTTAATATGTTTAAAGTGGTAGG - Intergenic
1012736343 6:102949889-102949911 TATCCAATGGTTGGAGTGGGAGG - Intergenic
1012864932 6:104607575-104607597 ATTGCTCTGGTTAATGTGGGTGG - Intergenic
1013077553 6:106784674-106784696 TTTCCTATGGTTAGATGGTGGGG + Intergenic
1014380970 6:120741704-120741726 TTTCCTATTTTTAAAGAGGGAGG + Intergenic
1015935040 6:138400740-138400762 TTTCCTATGGTTATGGAGGTTGG + Intergenic
1017032577 6:150237124-150237146 TTTCCCATGGCGAAAATGGGCGG + Intronic
1017156553 6:151327591-151327613 ATTCCTATGGTAAAAGGAGGTGG + Intronic
1024088552 7:45917181-45917203 TTTCCTCTTGTTAAAGGAGGAGG - Intronic
1027924188 7:84439256-84439278 CTTCCTGGGCTTAAAGTGGGAGG - Intronic
1028319396 7:89440532-89440554 ATGCCTGTGGTTAAAGTGTGAGG - Intergenic
1028488455 7:91385282-91385304 TTTCCTATGGGTAAGATGGGTGG - Intergenic
1028605953 7:92656060-92656082 TTTCCTATGGTTAAAGTGGGAGG + Intronic
1028843603 7:95454570-95454592 TTTCCAGTGGTTACAGTAGGGGG - Intergenic
1029250368 7:99232247-99232269 TTTCCCATCTGTAAAGTGGGTGG - Intergenic
1031820177 7:126490858-126490880 TTTCCAATTTTTAAAATGGGAGG - Intronic
1032440421 7:131938594-131938616 TTTCCTAGGGTGAAACTGGGTGG + Intergenic
1032607555 7:133372284-133372306 TTTCCTCTCGTTAAAATGGCTGG + Intronic
1034954586 7:155326761-155326783 TTTCTTATGCTTACAGTGGGGGG + Intergenic
1035023572 7:155812636-155812658 TTTCCTAAGATAAAGGTGGGCGG + Intergenic
1036071793 8:5448687-5448709 TTTCCTACTGTTGCAGTGGGAGG + Intergenic
1036626304 8:10475042-10475064 TTTCCTAGGGTGACAGTAGGGGG - Intergenic
1038703873 8:29876182-29876204 TTGCCAATGGTTAAGGAGGGAGG + Intergenic
1039140821 8:34385762-34385784 TTTCCTGTGGCTAAAATGGCAGG - Intergenic
1043750165 8:83925252-83925274 TGTCCCATGCTGAAAGTGGGGGG + Intergenic
1045189475 8:99868779-99868801 TTTCCTATGATAAATGTGGAAGG + Intronic
1046066669 8:109205450-109205472 CTGCCTATGGTGAAAGTGGAGGG - Intergenic
1052834635 9:33241314-33241336 TTTCCTCTGACTAAAATGGGAGG + Intronic
1053016945 9:34667263-34667285 TTTCCTCTGGTTGAAATGTGAGG + Intergenic
1053176507 9:35929232-35929254 TTCCCTCTGCTCAAAGTGGGAGG - Intergenic
1055800318 9:80028425-80028447 TTTCCTAAGAACAAAGTGGGTGG - Intergenic
1056537777 9:87546101-87546123 TTTCCTGTGGTGAGATTGGGTGG + Intronic
1059542254 9:115142687-115142709 TTTCTTATGGTTAGAGAGGCTGG - Intronic
1186097000 X:6112980-6113002 TTTCTCATGGTTATACTGGGGGG - Intronic
1186262563 X:7795228-7795250 TTTCTTATGGTGAAACTGAGTGG - Intergenic
1190515626 X:51221050-51221072 TTTACTATGAGTAAGGTGGGAGG - Intergenic
1193211640 X:78812953-78812975 TGTCCAATGGTAAGAGTGGGGGG - Intergenic
1194087671 X:89549325-89549347 TTTGCTATGTTTAAAGTGAATGG - Intergenic
1194234309 X:91362969-91362991 TTTCCTATGGGCAAATTGCGAGG + Intergenic
1194634939 X:96333909-96333931 GTGCCTATGGTTAAATTGAGTGG + Intergenic
1194889485 X:99360850-99360872 TTTCCTTTAGTAAAAGTGGATGG + Intergenic
1196368473 X:114948679-114948701 TTTCTTATTGTTAAAGTTTGAGG - Intergenic
1198504080 X:137283629-137283651 TTTCCTATCTATAAAGTGAGGGG + Intergenic
1200440316 Y:3205193-3205215 TTTGCTATGTTTAAAGTGAATGG - Intergenic
1200466619 Y:3528023-3528045 TTTCCTATGGCGAAAGAGTGAGG + Intergenic
1201720459 Y:17090572-17090594 TTTCCTATGGTGAAAGCATGGGG - Intergenic