ID: 1028608467

View in Genome Browser
Species Human (GRCh38)
Location 7:92681632-92681654
Sequence TGAGTTGGCTGAAGTACAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028608462_1028608467 29 Left 1028608462 7:92681580-92681602 CCATGTTAGTCCTGGACAGTGTG 0: 1
1: 0
2: 1
3: 12
4: 112
Right 1028608467 7:92681632-92681654 TGAGTTGGCTGAAGTACAACTGG No data
1028608464_1028608467 19 Left 1028608464 7:92681590-92681612 CCTGGACAGTGTGGTCGCAAATT 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1028608467 7:92681632-92681654 TGAGTTGGCTGAAGTACAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028608467 Original CRISPR TGAGTTGGCTGAAGTACAAC TGG Intronic
No off target data available for this crispr