ID: 1028608620

View in Genome Browser
Species Human (GRCh38)
Location 7:92683064-92683086
Sequence GTTTCTATGGTGAAAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028608620 Original CRISPR GTTTCTATGGTGAAAGCAGA GGG (reversed) Intronic
902030470 1:13418335-13418357 CTTTCTATGGGTCAAGCAGAGGG + Exonic
904719693 1:32498831-32498853 GTTTGTATGGCCAAAGCAGGTGG - Intronic
906771207 1:48486426-48486448 GGTGATATGATGAAAGCAGAGGG + Intergenic
908870255 1:68602369-68602391 ATTTCTTTAGTGAGAGCAGAAGG - Intergenic
909111669 1:71486399-71486421 GCTTTCATGGTGAAAGAAGAGGG + Intronic
913395885 1:118371668-118371690 GTTTCTTTAGTGAAATCATAGGG + Intergenic
915252209 1:154598631-154598653 GTCTCTTTGGAGAAGGCAGAAGG - Intronic
917204015 1:172549916-172549938 GTTTCTAAAATGAAAGCAGTAGG + Intronic
918059414 1:181048638-181048660 GCTTCTTTGGTAAAAGAAGAAGG + Intronic
918197991 1:182240629-182240651 GTTTCCATGAGGAAAGCTGAAGG - Intergenic
921476382 1:215615672-215615694 GTTTGTTTTGTGGAAGCAGAAGG + Intronic
921595259 1:217047669-217047691 GTTCCAATGGGGGAAGCAGATGG + Intronic
1064301427 10:14126507-14126529 GTGCCTATGGAGAAAGCGGAGGG - Intronic
1064669785 10:17700287-17700309 GTTTCCATGGTGATAGGAGTTGG + Intronic
1065256137 10:23870449-23870471 GTGTGTTTGGTGAAAGTAGAAGG - Intronic
1065671101 10:28118912-28118934 GTTTCTATGCTAAAAACAAAGGG + Intronic
1065829462 10:29601440-29601462 GATGCTATGGTGAAAGAATATGG - Intronic
1066625973 10:37406082-37406104 GTTCCTATGGTGAAATCAGGGGG - Intergenic
1069045002 10:63734110-63734132 GTTTCTATTATGAAAACAAATGG + Intergenic
1069166708 10:65169286-65169308 GTTTATTTGGTGAATGCCGACGG + Intergenic
1070753191 10:78975950-78975972 GTTTCTCTGGTGAATACAGGAGG - Intergenic
1070790355 10:79185555-79185577 GTTTATATTTGGAAAGCAGAGGG + Intronic
1070845153 10:79516001-79516023 GATTTTATGGGGAAAGCAGCTGG + Exonic
1070896451 10:79986499-79986521 GTTTCTATGGTGAAATAGGAAGG + Intergenic
1070928644 10:80244307-80244329 GATTTTATGGGGAAAGCAGCTGG - Intergenic
1070992163 10:80741932-80741954 GTCTCTGTGGTAAAAGGAGAAGG + Intergenic
1071025197 10:81104620-81104642 TTTTGTAAGGTTAAAGCAGAGGG + Intergenic
1073586230 10:104712725-104712747 GTTCCTATGTTGGAAGCAGTAGG - Intronic
1076270140 10:129145173-129145195 GTTTCTGTGTTCAAAGCAGAGGG - Intergenic
1077544049 11:3161253-3161275 GTGTGTTTGGTGAATGCAGATGG - Intronic
1078444613 11:11394883-11394905 GTTTCCATGGTGAGAGCATCAGG - Intronic
1079703686 11:23585755-23585777 TTTTATATGGTGAAAGCTGCAGG + Intergenic
1079703792 11:23587545-23587567 TTTTATATGGTGAAAGCTGCAGG - Intergenic
1079931887 11:26573585-26573607 ATTACTATGGTTAAGGCAGAAGG - Intronic
1080241545 11:30132915-30132937 GTTTCTCTGGAAAAATCAGACGG - Intergenic
1082186032 11:49182453-49182475 GTTTCAATAATGAAAGCAGAAGG + Intronic
1082576031 11:54804582-54804604 ATTTCTATGGATAAAGCAGTTGG - Intergenic
1084102999 11:66962408-66962430 CTTTCTGTGGAGAAAGCAGCAGG + Intergenic
1086680297 11:89662918-89662940 GTTTCAATAATGAAAGCAGAAGG - Intergenic
1090622153 11:128569870-128569892 GTTGCTTGGGTAAAAGCAGAAGG - Intronic
1091501685 12:1023876-1023898 GTTTCTCTGGAGAAGCCAGAGGG + Intronic
1091864345 12:3818279-3818301 GTTTCTTTTGTGAAGGAAGAAGG - Intronic
1092483189 12:8879097-8879119 GTTCCTATAGTGAGGGCAGATGG + Intronic
1093092845 12:14940517-14940539 TTTTATATGGTGAAAGATGAGGG - Intergenic
1094158893 12:27368967-27368989 GTTTATATGGTGAAAACATCAGG + Intronic
1094773893 12:33698996-33699018 ATTTTTATTGTGATAGCAGATGG + Intergenic
1097042027 12:56161540-56161562 GTTTATTTGGTGAATGCTGACGG - Exonic
1097290249 12:57908448-57908470 ATTACTATGGTGGATGCAGATGG - Intergenic
1097613748 12:61859331-61859353 GTGTCAATGGTGGGAGCAGATGG - Intronic
1099097060 12:78387872-78387894 TTTTCTATTGTGAAACCATATGG + Intergenic
1099426412 12:82529164-82529186 GTTCTTATGTTGAAAGTAGAGGG - Intergenic
1099600555 12:84731019-84731041 GTTTCCATGGAGCAAACAGAAGG + Intergenic
1105653877 13:22412405-22412427 GTTTTTCTGGTGTAAACAGAAGG - Intergenic
1106043290 13:26114410-26114432 GTGTCTATGGTGACAGAGGATGG + Intergenic
1106946418 13:34832529-34832551 TAATCTATGGAGAAAGCAGAGGG - Intergenic
1107061917 13:36168518-36168540 GTTTGGATGGTGAATGAAGAAGG + Exonic
1108712070 13:53043342-53043364 ATTGCAATGGTGAAAGAAGAAGG + Intronic
1108759251 13:53543047-53543069 GTTTCTATGGAGAAAGAACTTGG + Intergenic
1109106161 13:58253294-58253316 ATTGCTATGGTGTAAGCAAAAGG - Intergenic
1109918244 13:69020584-69020606 ATTTCTATGGGGAAAGAAAACGG + Intergenic
1110885529 13:80629202-80629224 GTGTCTTGGGAGAAAGCAGAAGG + Intergenic
1111504636 13:89171848-89171870 GTTGCTATTGAGAAAGCAGTAGG + Intergenic
1111562833 13:89974459-89974481 GTTTATGTGGTCAAAGCAGGAGG + Intergenic
1116186004 14:41601547-41601569 GTCCCTATGGTGTAAGAAGAAGG + Intergenic
1116640659 14:47458454-47458476 TTGTGTATGGTGAGAGCAGAGGG + Intronic
1117168993 14:53070933-53070955 CTTTCTCTTATGAAAGCAGAGGG + Intronic
1117583129 14:57172885-57172907 GTTTCTATGGTGATGGGAGAAGG - Intergenic
1117625208 14:57629457-57629479 ATTTCCATGGTGCAACCAGAAGG + Intronic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1119726895 14:76926872-76926894 GTTTCCATGGTGACAGCAGCTGG + Intergenic
1119950576 14:78739925-78739947 GCTTCTGTGGTCAGAGCAGAAGG + Intronic
1120468228 14:84888626-84888648 GTTTCTATGGTGAAATTTGATGG + Intergenic
1121411836 14:93753574-93753596 TTTTCTCTGGTGGAAGCAGGGGG + Intronic
1122689982 14:103527705-103527727 GTTTCAACGTTGAGAGCAGAAGG + Intergenic
1124045501 15:26146344-26146366 GTTGTCATGGTGACAGCAGAAGG - Intergenic
1124157572 15:27240235-27240257 CTTGCTATAGTGAAAGCAGCAGG + Intronic
1124531963 15:30516384-30516406 GGTTGTGTGGTGAAAGTAGAGGG + Intergenic
1124766690 15:32491261-32491283 GGTTGTGTGGTGAAAGTAGAGGG - Intergenic
1129283262 15:74502729-74502751 GAGTCTATGGTGATAGAAGAAGG - Intergenic
1132279095 15:100597000-100597022 TATTCTATGATGAAAGGAGAGGG - Intronic
1133440622 16:5818019-5818041 GTCTTTATGGTGAAAGCAGTAGG + Intergenic
1136033918 16:27524157-27524179 GTGTCTGTGGTGAAAGGGGAAGG + Intronic
1137905495 16:52318095-52318117 GCTTCCATGGTGAATGCAGAGGG - Intergenic
1138924311 16:61572159-61572181 GTGTGTATGGTGAAAGGAAATGG + Intergenic
1141680913 16:85543311-85543333 GATTCTATAGAGATAGCAGAGGG + Intergenic
1143709560 17:8724997-8725019 GTTTCAAAGGTGAAAGCTAAGGG + Intergenic
1143709677 17:8725669-8725691 GTTTCAAAGGTGAAAGCTAAGGG + Intergenic
1144062326 17:11594425-11594447 GTTTATATAGTGCAAGCGGAAGG - Intergenic
1149613502 17:57976881-57976903 AATTCTTTGGTGAAAGCAGGTGG - Intronic
1152172810 17:78764709-78764731 GTTTCTATATCAAAAGCAGAGGG + Intronic
1155801689 18:30113474-30113496 GTTTCTATGATTTAAGCAAAGGG - Intergenic
1155884184 18:31187186-31187208 CTTTGTATGGTGAAAGAAGTGGG + Intergenic
1158323570 18:56290335-56290357 GTTCATCTGGTGAAACCAGAAGG - Intergenic
1159481643 18:68996940-68996962 GTTTCAAAGGAGAAACCAGATGG + Intronic
1159856868 18:73599196-73599218 GTTTGAATGGAGAAGGCAGATGG - Intergenic
1161807442 19:6452870-6452892 GTTTCTGATATGAAAGCAGAAGG - Intronic
1163647183 19:18496017-18496039 GTTTATATGGGGACTGCAGAGGG + Intronic
1164375288 19:27678737-27678759 GTGTCTATGTAGAAAGAAGAAGG - Intergenic
925234147 2:2263332-2263354 GTTTCTGGGATGTAAGCAGAGGG - Intronic
930794034 2:55368948-55368970 GTTTATATGGTCACAGCTGAAGG + Intronic
931183064 2:59923044-59923066 GTTTCTGTTGTGCAAGCAAAGGG - Intergenic
931189314 2:59984260-59984282 GGTTCTATGTGGAAAGCAGTGGG - Intergenic
932018294 2:68055839-68055861 ATTTCTATAGTGAAATTAGATGG + Intronic
933710711 2:85323807-85323829 GTTGCTATGCTGAAAGCAGAAGG + Intronic
935012034 2:99144485-99144507 GTTTTGATGCTGAAAGCAGGCGG + Intronic
937734457 2:125272734-125272756 CTTTTTATGGAGTAAGCAGATGG - Intergenic
938580135 2:132638250-132638272 GTGTCTACAGTCAAAGCAGACGG - Intronic
939413476 2:141862239-141862261 GTTTCTGTGGAGAAATTAGAGGG - Intronic
942164350 2:173227624-173227646 GTTTTAATGTTGAAAGGAGAGGG - Intronic
944021697 2:195113506-195113528 GTGTCAAAGGTGAAACCAGATGG + Intergenic
944121128 2:196242032-196242054 GTATAGATGGTGAAAGGAGAGGG - Intronic
947097448 2:226582164-226582186 GTGTTTATGGTGAGTGCAGAGGG - Intergenic
947198798 2:227596312-227596334 GTTTCTTGTGTGAAAGCAAAGGG + Intergenic
948239562 2:236418519-236418541 GTGTTTATGCTGAAAGCATATGG + Intronic
948736525 2:240011100-240011122 CTTTCTTTGTTGAAAGCACATGG - Intronic
1169762855 20:9115162-9115184 GTTTCTATGCTGAGAACAGTGGG + Intronic
1170005042 20:11658589-11658611 GCTTCTGTGTTGGAAGCAGAGGG + Intergenic
1171301969 20:24070476-24070498 GTGTCTATTGTGAAATCAGTTGG + Intergenic
1172331345 20:34078034-34078056 GGTTCTATCGTGAGAACAGATGG + Intronic
1173529933 20:43761394-43761416 GTTTCTAGGGAGAAATGAGAAGG + Intergenic
1174592793 20:51659297-51659319 GTTTCTATGGTCTAATGAGAGGG - Intronic
1177814565 21:25961749-25961771 GTTTCTATAGAGATAACAGAGGG - Intronic
1177868306 21:26539359-26539381 GTTACTGTGTTGAAATCAGAGGG - Intronic
1177959960 21:27651318-27651340 CTTTTTTTTGTGAAAGCAGATGG + Intergenic
1179808595 21:43855743-43855765 GTTTATATGGTGAATGCTGATGG + Intergenic
1182192546 22:28477819-28477841 GTTTTCATGGTGAAGCCAGAAGG - Intronic
1182580769 22:31309349-31309371 GTTTCAGTGATGAAAGTAGATGG + Intergenic
1182786510 22:32912280-32912302 GTTTTTTTGGTGAAATAAGAAGG + Intronic
1183650565 22:39151364-39151386 TTCTCTATGGAGAAAGAAGATGG + Intronic
1183851988 22:40597646-40597668 TTTTCTCTGCCGAAAGCAGAGGG + Intronic
949635249 3:5975124-5975146 CATTATATGGTGAAAGCAGAAGG - Intergenic
952818044 3:37462668-37462690 GTTTCTAAGGAAAAAGGAGAAGG + Intronic
953527435 3:43704388-43704410 GCATTTATGGTGAAAGGAGAAGG + Intronic
953651452 3:44808941-44808963 GTTTCTATGGCTTAAGTAGATGG + Intronic
953901277 3:46845579-46845601 GTTTCTACTGGGAAAGCAGCGGG - Intergenic
955723762 3:61910742-61910764 GGTTCTGTGGGGAAAGCAGGTGG - Intronic
956296168 3:67716006-67716028 GTGGCTATGGTGAGGGCAGATGG - Intergenic
961374050 3:126450663-126450685 GCTGCCATGATGAAAGCAGAAGG - Intronic
961502885 3:127350182-127350204 GTTCCTTTGGAGAAAGCAGGGGG + Intergenic
962299134 3:134222082-134222104 GCTGCTGTGGTGAAAGGAGATGG - Intronic
963866938 3:150371599-150371621 GTTTCTATGTGTATAGCAGATGG + Intergenic
964458464 3:156894861-156894883 TTGTATATGGTGAAAGCAAAGGG - Intronic
964500820 3:157346451-157346473 GTTTCTAAGTTGAAATTAGATGG + Intronic
967360213 3:188622050-188622072 ATTTCTATGATGAAATCAGTTGG + Intronic
969343069 4:6554376-6554398 GTTTCTATGGAGGAATTAGAGGG - Intronic
970526772 4:16940539-16940561 GCTGCCACGGTGAAAGCAGAGGG - Intergenic
971236838 4:24849958-24849980 GCTTCTGTGGAGAGAGCAGAGGG - Intronic
971334543 4:25710653-25710675 TTTCCTAAGGTGAAATCAGAGGG + Intergenic
971696602 4:29912350-29912372 TTGTATATGGTGAAAGGAGAGGG - Intergenic
972699721 4:41482434-41482456 GTATTTATGGAGAAAGGAGAAGG + Intronic
972712572 4:41612349-41612371 CTTTCTATTGGGAATGCAGAGGG + Intronic
979463431 4:121008773-121008795 ATTTATAAGGTGAAAGCTGATGG + Intergenic
981534641 4:145786601-145786623 TTTTCCATGCAGAAAGCAGAGGG + Intronic
982540350 4:156661822-156661844 GTTTTTAATGTGAAAGCAGGAGG - Intergenic
985344845 4:188993218-188993240 GTTACAATGGTGAAAGCAAAGGG - Intergenic
986357919 5:6947055-6947077 ATTTCAATGGTGAAAGATGATGG - Intergenic
988143176 5:27268647-27268669 GTTTCTTTGTTTATAGCAGATGG - Intergenic
988835556 5:35028923-35028945 GTTTTGATGGTGATTGCAGAAGG - Intronic
990482952 5:56229337-56229359 GTTGCTATGGTGAAAGCTGAAGG + Intronic
991516878 5:67446350-67446372 GTTTCTCTGATGAACGCTGATGG - Intergenic
991933221 5:71776168-71776190 GGCTCTATTGTGAAAGCAAAAGG + Intergenic
992383064 5:76257594-76257616 GTGTCTATAGTGTCAGCAGATGG + Intronic
993286965 5:86011785-86011807 GCCTCTCTGGTGAGAGCAGAAGG + Intergenic
993352529 5:86867867-86867889 GTTTTCATGGGGAAAGCAGAAGG - Intergenic
993828744 5:92727011-92727033 GATTCTATTGTTAAAGAAGAAGG - Intergenic
997789626 5:136746281-136746303 GTTTATATGGTGAGAGCTGGGGG - Intergenic
1000134413 5:158332516-158332538 TTGTATATGGTGAAAGAAGAGGG + Intergenic
1002048302 5:176554319-176554341 GTTTCCATGGTGATTGCAGTGGG + Intronic
1002841700 6:912047-912069 GTTTCTCTGGAGAAAGGAAAGGG - Intergenic
1004736918 6:18416069-18416091 GTTTCTTTGGAGAAAGTAGAAGG + Intronic
1006598258 6:35209207-35209229 GTTTCCTTAGTGAAAGCAGCTGG + Intergenic
1007048453 6:38801222-38801244 GTTTGTATGGTGTAAGGAGAAGG + Intronic
1009871430 6:69457246-69457268 GTATCCATGGTGGAAGAAGAAGG - Intergenic
1011519109 6:88184656-88184678 GTTTCTTTGGCGAAGGGAGAAGG - Intergenic
1012191614 6:96287093-96287115 GTCTCTATGGAGAAAGCATATGG + Intergenic
1013832498 6:114291214-114291236 TTTTCTTTGGAGCAAGCAGAAGG + Intronic
1014179491 6:118369394-118369416 TTTTATATGGTGAAAGGAAAGGG - Intergenic
1014689670 6:124548083-124548105 TTTTCTCTTATGAAAGCAGAAGG + Intronic
1014825143 6:126041553-126041575 GTTTCTCTGTTGAAAACTGAAGG + Intergenic
1015343930 6:132133187-132133209 TTTTCACTGGTGAAAGAAGAGGG - Intergenic
1018235625 6:161720700-161720722 TTTTCTATTTTGAAAGCAAAGGG - Intronic
1021515468 7:21479653-21479675 GTTTCTATAAAGAAACCAGATGG + Intronic
1022209307 7:28193407-28193429 GTCTCTAGGGTAAAAGCAGGGGG - Intergenic
1023495793 7:40795396-40795418 ATTTATTTGGTGAAAGAAGATGG - Intronic
1027052018 7:75026500-75026522 GTTTCTGTGGTCAGAGGAGAAGG + Intergenic
1028608620 7:92683064-92683086 GTTTCTATGGTGAAAGCAGAGGG - Intronic
1028633506 7:92961897-92961919 TTTTGTGTGGTCAAAGCAGAGGG + Intergenic
1028726575 7:94094787-94094809 GTTTTTAGGGTGAAACCAGAAGG - Intergenic
1032845016 7:135744840-135744862 GTTACTATGGAGAGAGGAGATGG + Intronic
1034886022 7:154799459-154799481 GGTTCTATGGCAAATGCAGATGG - Intronic
1036394733 8:8359969-8359991 GTTTCCAGGGTCAAAGGAGAAGG - Intronic
1039074519 8:33677755-33677777 GGTTCCATGCTGAAAGCAGGAGG - Intergenic
1041228699 8:55727903-55727925 GTTTCTATGGCCAAATAAGAAGG + Intronic
1043008856 8:74856712-74856734 CTTTCTATGCTGAGAGCAGCAGG - Intergenic
1043714542 8:83466004-83466026 GTGTCTAGGGAGAAACCAGATGG + Intergenic
1045569057 8:103351193-103351215 GATTATATGGGGAAAGCAGTTGG - Intergenic
1045654518 8:104373241-104373263 GTTTCTAAGATGACATCAGATGG + Intronic
1045857863 8:106784650-106784672 GTTCCTATGGGGAAGGAAGAAGG - Intergenic
1046680011 8:117158299-117158321 ATTTCTATGGGGTGAGCAGATGG + Intronic
1047472323 8:125188808-125188830 GGTTCTATTGAAAAAGCAGATGG + Intronic
1048237139 8:132701821-132701843 ATTGCTCTGGTGGAAGCAGAGGG - Intronic
1050466373 9:5928619-5928641 ATTTCTGAGGGGAAAGCAGAGGG - Intronic
1052902856 9:33809427-33809449 GTTTCAGTGGTGAGGGCAGAGGG + Intergenic
1053369188 9:37546231-37546253 CTTACTATGGTGTAAGAAGATGG + Intronic
1053487721 9:38472460-38472482 GTTTCAGTGGTGAGGGCAGAGGG - Intergenic
1054724864 9:68640168-68640190 GCTGCTTTGGGGAAAGCAGAAGG + Intergenic
1054789085 9:69238115-69238137 GTGTCTATGGTGCAGGCAGTGGG - Intronic
1056637806 9:88346003-88346025 GTTTATAAGGTGAAAGAAGTTGG + Intergenic
1056977344 9:91270404-91270426 GTTTCTATGAGGAAAGCACAGGG - Intronic
1060223260 9:121775365-121775387 GTAACTATGGTGAAAGCAGGTGG - Intronic
1185553568 X:1002863-1002885 GTGTCTATGGCGATGGCAGACGG + Intergenic
1185936143 X:4258510-4258532 TTTCCTAGGGTGAAAGCATAGGG - Intergenic
1187274813 X:17807923-17807945 GTTTCTATGGAGCATGGAGACGG + Intronic
1192353909 X:70381790-70381812 GTTTCTGTGAAGAAACCAGATGG - Intronic
1193378400 X:80789248-80789270 GTTTCTCTGCTGCAAACAGAAGG + Intronic
1193730468 X:85096687-85096709 GTTTCTGATGGGAAAGCAGATGG - Intronic
1196691742 X:118566435-118566457 ATTTCTATTATGAAAGCATAGGG - Intronic
1197622881 X:128770905-128770927 CTTTCACTGGTGTAAGCAGAAGG - Intergenic
1201720459 Y:17090572-17090594 TTTCCTATGGTGAAAGCATGGGG - Intergenic
1202626852 Y:56868644-56868666 TTTTTAATGGTTAAAGCAGAGGG + Intergenic