ID: 1028609466

View in Genome Browser
Species Human (GRCh38)
Location 7:92693422-92693444
Sequence TGATCTAGAAGGTGACTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028609460_1028609466 27 Left 1028609460 7:92693372-92693394 CCACAAGTTCTTTCAAAAGCTCT 0: 1
1: 1
2: 2
3: 30
4: 276
Right 1028609466 7:92693422-92693444 TGATCTAGAAGGTGACTCTCAGG No data
1028609464_1028609466 0 Left 1028609464 7:92693399-92693421 CCTAGTAGCAAAGTGGGCTGGCG 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1028609466 7:92693422-92693444 TGATCTAGAAGGTGACTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028609466 Original CRISPR TGATCTAGAAGGTGACTCTC AGG Intronic
No off target data available for this crispr