ID: 1028614270

View in Genome Browser
Species Human (GRCh38)
Location 7:92747635-92747657
Sequence GACTGGCTTCCTAAAGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028614270_1028614273 7 Left 1028614270 7:92747635-92747657 CCACTTTCTTTAGGAAGCCAGTC 0: 1
1: 0
2: 0
3: 23
4: 218
Right 1028614273 7:92747665-92747687 TTCCCTCTTCTGAATTCCTGTGG 0: 1
1: 0
2: 2
3: 36
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028614270 Original CRISPR GACTGGCTTCCTAAAGAAAG TGG (reversed) Intronic