ID: 1028617164

View in Genome Browser
Species Human (GRCh38)
Location 7:92781467-92781489
Sequence GGCAAGTTGCCTTCATCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028617161_1028617164 24 Left 1028617161 7:92781420-92781442 CCTGTTCATGTTCTCAATTTAAC 0: 1
1: 0
2: 0
3: 13
4: 183
Right 1028617164 7:92781467-92781489 GGCAAGTTGCCTTCATCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028617164 Original CRISPR GGCAAGTTGCCTTCATCTAA TGG Intronic
No off target data available for this crispr