ID: 1028621991

View in Genome Browser
Species Human (GRCh38)
Location 7:92835770-92835792
Sequence CACACGGACGGGCGCGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028621983_1028621991 11 Left 1028621983 7:92835736-92835758 CCCGCGTGTGCGCACACGCAGAT 0: 1
1: 0
2: 0
3: 8
4: 71
Right 1028621991 7:92835770-92835792 CACACGGACGGGCGCGCTGCGGG No data
1028621982_1028621991 19 Left 1028621982 7:92835728-92835750 CCGCGACTCCCGCGTGTGCGCAC 0: 1
1: 0
2: 1
3: 4
4: 37
Right 1028621991 7:92835770-92835792 CACACGGACGGGCGCGCTGCGGG No data
1028621981_1028621991 26 Left 1028621981 7:92835721-92835743 CCGGGGACCGCGACTCCCGCGTG 0: 1
1: 0
2: 0
3: 3
4: 101
Right 1028621991 7:92835770-92835792 CACACGGACGGGCGCGCTGCGGG No data
1028621984_1028621991 10 Left 1028621984 7:92835737-92835759 CCGCGTGTGCGCACACGCAGATG 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1028621991 7:92835770-92835792 CACACGGACGGGCGCGCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028621991 Original CRISPR CACACGGACGGGCGCGCTGC GGG Intronic
No off target data available for this crispr