ID: 1028638265

View in Genome Browser
Species Human (GRCh38)
Location 7:93015409-93015431
Sequence GTTGCCACCCGGGCTTAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028638265_1028638271 20 Left 1028638265 7:93015409-93015431 CCCATCTAAGCCCGGGTGGCAAC No data
Right 1028638271 7:93015452-93015474 ATGCCTGATAAAATTTCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028638265 Original CRISPR GTTGCCACCCGGGCTTAGAT GGG (reversed) Intergenic
No off target data available for this crispr