ID: 1028638441

View in Genome Browser
Species Human (GRCh38)
Location 7:93016717-93016739
Sequence GGACAGCATTCTGACTTCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028638441_1028638443 -6 Left 1028638441 7:93016717-93016739 CCGCGGAAGTCAGAATGCTGTCC No data
Right 1028638443 7:93016734-93016756 CTGTCCTTCACCCAGTGGATTGG No data
1028638441_1028638445 -4 Left 1028638441 7:93016717-93016739 CCGCGGAAGTCAGAATGCTGTCC No data
Right 1028638445 7:93016736-93016758 GTCCTTCACCCAGTGGATTGGGG No data
1028638441_1028638447 1 Left 1028638441 7:93016717-93016739 CCGCGGAAGTCAGAATGCTGTCC No data
Right 1028638447 7:93016741-93016763 TCACCCAGTGGATTGGGGCCTGG No data
1028638441_1028638444 -5 Left 1028638441 7:93016717-93016739 CCGCGGAAGTCAGAATGCTGTCC No data
Right 1028638444 7:93016735-93016757 TGTCCTTCACCCAGTGGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028638441 Original CRISPR GGACAGCATTCTGACTTCCG CGG (reversed) Intergenic
No off target data available for this crispr