ID: 1028638442

View in Genome Browser
Species Human (GRCh38)
Location 7:93016729-93016751
Sequence GAATGCTGTCCTTCACCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028638440_1028638442 -7 Left 1028638440 7:93016713-93016735 CCATCCGCGGAAGTCAGAATGCT No data
Right 1028638442 7:93016729-93016751 GAATGCTGTCCTTCACCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028638442 Original CRISPR GAATGCTGTCCTTCACCCAG TGG Intergenic
No off target data available for this crispr