ID: 1028638443

View in Genome Browser
Species Human (GRCh38)
Location 7:93016734-93016756
Sequence CTGTCCTTCACCCAGTGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028638441_1028638443 -6 Left 1028638441 7:93016717-93016739 CCGCGGAAGTCAGAATGCTGTCC No data
Right 1028638443 7:93016734-93016756 CTGTCCTTCACCCAGTGGATTGG No data
1028638440_1028638443 -2 Left 1028638440 7:93016713-93016735 CCATCCGCGGAAGTCAGAATGCT No data
Right 1028638443 7:93016734-93016756 CTGTCCTTCACCCAGTGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028638443 Original CRISPR CTGTCCTTCACCCAGTGGAT TGG Intergenic
No off target data available for this crispr