ID: 1028638444

View in Genome Browser
Species Human (GRCh38)
Location 7:93016735-93016757
Sequence TGTCCTTCACCCAGTGGATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028638441_1028638444 -5 Left 1028638441 7:93016717-93016739 CCGCGGAAGTCAGAATGCTGTCC No data
Right 1028638444 7:93016735-93016757 TGTCCTTCACCCAGTGGATTGGG No data
1028638440_1028638444 -1 Left 1028638440 7:93016713-93016735 CCATCCGCGGAAGTCAGAATGCT No data
Right 1028638444 7:93016735-93016757 TGTCCTTCACCCAGTGGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028638444 Original CRISPR TGTCCTTCACCCAGTGGATT GGG Intergenic
No off target data available for this crispr