ID: 1028638928

View in Genome Browser
Species Human (GRCh38)
Location 7:93021763-93021785
Sequence CAGGAAAAAGAGAAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028638922_1028638928 29 Left 1028638922 7:93021711-93021733 CCAGCAGAAGTCCAATACATCAA No data
Right 1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG No data
1028638924_1028638928 18 Left 1028638924 7:93021722-93021744 CCAATACATCAATCATAAAGGAA No data
Right 1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028638928 Original CRISPR CAGGAAAAAGAGAAGGAGAA AGG Intergenic
No off target data available for this crispr