ID: 1028639925

View in Genome Browser
Species Human (GRCh38)
Location 7:93030261-93030283
Sequence TGTCAGCTAAAGCACTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028639925_1028639930 22 Left 1028639925 7:93030261-93030283 CCTACAAAGTGCTTTAGCTGACA No data
Right 1028639930 7:93030306-93030328 CAGTGGTCTGTCAATACCTCAGG No data
1028639925_1028639927 5 Left 1028639925 7:93030261-93030283 CCTACAAAGTGCTTTAGCTGACA No data
Right 1028639927 7:93030289-93030311 CATTGCAGTGTTGTGCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028639925 Original CRISPR TGTCAGCTAAAGCACTTTGT AGG (reversed) Intergenic
No off target data available for this crispr