ID: 1028646128

View in Genome Browser
Species Human (GRCh38)
Location 7:93098679-93098701
Sequence CTGCTGGCATTGAGGAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028646123_1028646128 -2 Left 1028646123 7:93098658-93098680 CCAGAGGCTGTAGGTTGCCCACT No data
Right 1028646128 7:93098679-93098701 CTGCTGGCATTGAGGAAATAAGG No data
1028646122_1028646128 -1 Left 1028646122 7:93098657-93098679 CCCAGAGGCTGTAGGTTGCCCAC No data
Right 1028646128 7:93098679-93098701 CTGCTGGCATTGAGGAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028646128 Original CRISPR CTGCTGGCATTGAGGAAATA AGG Intergenic
No off target data available for this crispr