ID: 1028648063

View in Genome Browser
Species Human (GRCh38)
Location 7:93120217-93120239
Sequence CTGTGTCAGGGGGAAGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028648063_1028648069 -6 Left 1028648063 7:93120217-93120239 CCCAGATCTTCCCCCTGACACAG No data
Right 1028648069 7:93120234-93120256 ACACAGTCACCCAAATGAGAAGG No data
1028648063_1028648072 14 Left 1028648063 7:93120217-93120239 CCCAGATCTTCCCCCTGACACAG No data
Right 1028648072 7:93120254-93120276 AGGAACCAGAAAAACAATTCTGG 0: 163
1: 257
2: 480
3: 621
4: 915

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028648063 Original CRISPR CTGTGTCAGGGGGAAGATCT GGG (reversed) Intergenic
No off target data available for this crispr