ID: 1028649161

View in Genome Browser
Species Human (GRCh38)
Location 7:93131296-93131318
Sequence TATTCAGGTCCACTCAGAAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028649161_1028649163 -8 Left 1028649161 7:93131296-93131318 CCACTTCTGAGTGGACCTGAATA 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1028649163 7:93131311-93131333 CCTGAATAAACAGATATTACTGG 0: 1
1: 0
2: 2
3: 21
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028649161 Original CRISPR TATTCAGGTCCACTCAGAAG TGG (reversed) Exonic
900838558 1:5027452-5027474 TATCCACGTCCACTCACAATGGG + Intergenic
907284028 1:53368896-53368918 TGCTCAGGTCCACTCTGACGGGG + Intergenic
908316504 1:62937764-62937786 TATTCAGGCTCACACAGAGGAGG + Intergenic
908490907 1:64643250-64643272 TATTCAGATCCTCTTAGGAGGGG + Intronic
914985362 1:152451495-152451517 TGCTCAGGTCCACTCCGGAGAGG + Intergenic
915057832 1:153151986-153152008 TATTTAGTTCCACACAGTAGTGG - Intergenic
920316025 1:205076106-205076128 TAATGAGGTCCACTAAAAAGGGG + Exonic
1063866110 10:10367156-10367178 TTCTGAGGCCCACTCAGAAGAGG - Intergenic
1064510783 10:16088573-16088595 TGTGCAGGTCCACTCACATGTGG - Intergenic
1064932237 10:20640706-20640728 AATCCAGGCCCACTGAGAAGAGG + Intergenic
1072557757 10:96536612-96536634 TGTTCAAGTCCACTTACAAGTGG + Intronic
1078042946 11:7884862-7884884 TTCTGAGCTCCACTCAGAAGTGG + Intergenic
1082187953 11:49207700-49207722 TGTTCAAGGCCACTAAGAAGTGG + Intronic
1084957528 11:72699222-72699244 TATTCTGGTCCCCTAAGAGGTGG + Intronic
1086678364 11:89637689-89637711 TGTTCAAGGCCACTAAGAAGTGG - Intergenic
1088967460 11:114738122-114738144 AATTCAGGGGCACTGAGAAGTGG - Intergenic
1093436399 12:19139771-19139793 TATTCTGATCCACTCTGCAGGGG - Intronic
1103399054 12:120630131-120630153 TAATGAGGTCCTCTTAGAAGGGG + Intergenic
1106627909 13:31440099-31440121 AATTCAGGCACACTCAGAAGAGG + Intergenic
1108052154 13:46456175-46456197 TATTCAAGTCTTCTCAGTAGAGG - Intergenic
1109176619 13:59165876-59165898 TACCCAGGTCCACTGTGAAGTGG + Intergenic
1115131292 14:30055190-30055212 CATTCATGTTCACTCTGAAGAGG - Intronic
1115452801 14:33567455-33567477 TATTAGTGTCCTCTCAGAAGTGG + Intronic
1131575215 15:93582680-93582702 TATGCAGGTCCACTTATATGTGG + Intergenic
1131993854 15:98115492-98115514 TATTATGCTTCACTCAGAAGTGG - Intergenic
1135856151 16:26012424-26012446 TCTTCAGTTCCACATAGAAGAGG - Intronic
1138117125 16:54369677-54369699 GATACAGGTCCTCTCAGATGGGG + Intergenic
1141593355 16:85082962-85082984 CTTTCAGGTCTGCTCAGAAGGGG - Intronic
1142819483 17:2454163-2454185 TATTCACCCCAACTCAGAAGTGG + Intronic
1144306842 17:13976460-13976482 TTTTCTGGACCACTCAGTAGAGG - Intergenic
1146432647 17:32812242-32812264 TATTGAGGGCTACACAGAAGTGG + Intronic
1151071524 17:71218443-71218465 TTTTCTGTTCCACTCATAAGCGG - Intergenic
1157324059 18:46656658-46656680 TATTCTGTTCCACTGAGAATCGG + Intronic
926010352 2:9401566-9401588 TAATCAGGCCTGCTCAGAAGGGG - Intronic
927174891 2:20398987-20399009 TATCCAGCTCCTCTCAAAAGAGG + Intergenic
930119885 2:47751893-47751915 AAGTCAAGTCCACTTAGAAGAGG + Intronic
930858902 2:56049401-56049423 CATTAAGGTGCACTGAGAAGGGG - Intergenic
931222520 2:60300848-60300870 AATTCTGGTCATCTCAGAAGAGG + Intergenic
935406343 2:102714023-102714045 TATACAGGTCCACTTAAACGGGG + Intergenic
940099312 2:150015961-150015983 GAATGAGGTCCACTCACAAGAGG + Intergenic
944399128 2:199305165-199305187 TATGCATGTACACTCAGAGGAGG + Intronic
946246437 2:218390492-218390514 GACTGAGATCCACTCAGAAGGGG - Intronic
946877431 2:224143798-224143820 CATTCTGGTCGAGTCAGAAGAGG - Intergenic
946942878 2:224788106-224788128 TATACAGTTGCAATCAGAAGGGG - Intronic
947126205 2:226870937-226870959 TATGCAGGTCCACTTACATGAGG - Intronic
947408647 2:229809698-229809720 TCTTCAGGACCACTCAAAATAGG + Intronic
1172411430 20:34726456-34726478 TATTCAGGACCTATCTGAAGTGG + Intronic
1177804851 21:25864927-25864949 TAGAGAGGTCCACTCATAAGAGG + Intergenic
1179516747 21:41913812-41913834 GATTCAGAACCACCCAGAAGGGG + Intronic
1184098668 22:42330078-42330100 TCTGCAGGGCCACTCAGATGGGG - Intronic
955141536 3:56274526-56274548 TACACAGGTCCACTCATATGTGG - Intronic
957632694 3:82738051-82738073 TATTTGGGTATACTCAGAAGAGG + Intergenic
963581516 3:147131672-147131694 AAATCATGTCCACTGAGAAGAGG + Intergenic
966259403 3:177956976-177956998 GATTCTGGTCCACCAAGAAGGGG - Intergenic
971128769 4:23782671-23782693 AAGTCAGGTGCAATCAGAAGGGG - Intronic
972671635 4:41217650-41217672 TATTCAATGCCACTTAGAAGTGG - Intergenic
974198297 4:58605249-58605271 TACTCAGCTCCACTTATAAGTGG + Intergenic
976827854 4:89280607-89280629 AATTCAGGTCCACCTAGAACCGG + Intronic
978130936 4:105196411-105196433 TATTCAGGGCCACTCTGAAAAGG - Intronic
983100333 4:163618212-163618234 CATTCAGGTGAACTCAGAAGAGG - Intronic
985859204 5:2457361-2457383 TTTTCAGCTAGACTCAGAAGTGG + Intergenic
988364251 5:30275755-30275777 CATGCAGGTCCACTCAGAATAGG + Intergenic
988632372 5:32944836-32944858 TATTCTTGACCCCTCAGAAGGGG + Intergenic
989364550 5:40640854-40640876 TCTGCAGGTCCACTCATATGAGG + Intergenic
990572643 5:57094676-57094698 AAATCAGGTCCTCTCAGGAGAGG + Intergenic
992063320 5:73079678-73079700 TATGCAGGTCCACTTATACGAGG + Intronic
995032035 5:107491704-107491726 TATTCAGTTCCCCTCTGAAGAGG - Intronic
995927259 5:117388843-117388865 TATTCACATGCCCTCAGAAGTGG + Intergenic
997034286 5:130169300-130169322 TATTCAGATATACTCAGAAATGG - Intronic
1006229267 6:32568478-32568500 TAATCAAGTCCCCTCAGAAAGGG + Intronic
1011267422 6:85536909-85536931 TATTCAGGAACACACAGAAAAGG - Exonic
1011841339 6:91503633-91503655 TAAGCAGGGCCACTGAGAAGTGG - Intergenic
1015053985 6:128876909-128876931 TACTCAGGTGCACTCAAAATGGG + Intergenic
1015903845 6:138095973-138095995 CATTCAGGTCCCCTCAGCAGGGG + Intronic
1016348580 6:143142548-143142570 TCCTCAGGCCCACTCAGAAAGGG - Intronic
1021677936 7:23099517-23099539 TACTCACTTCCAATCAGAAGTGG - Intergenic
1022402231 7:30050616-30050638 GATTCAGGCTCACTCAAAAGAGG - Intronic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1028646364 7:93101407-93101429 TTTTTAGGTCAACTTAGAAGTGG - Exonic
1028649161 7:93131296-93131318 TATTCAGGTCCACTCAGAAGTGG - Exonic
1029461953 7:100699846-100699868 TATTCATGTCCCCTCAGCACAGG + Intergenic
1030738955 7:113085791-113085813 TATTCCGGGCCAGTGAGAAGTGG - Intronic
1034411867 7:150946238-150946260 CATGCAGGTCCACCCAGGAGAGG + Intronic
1039703284 8:39982714-39982736 TATCCTGGTCCACTCAGACTTGG + Exonic
1041073810 8:54150774-54150796 TTTTCAGTTCAGCTCAGAAGCGG - Intergenic
1041436791 8:57850679-57850701 TATTCAGATCCGCTCAGATTTGG - Intergenic
1041800482 8:61792531-61792553 TATACAGTTCTACTCAGAGGTGG - Intergenic
1043192461 8:77243261-77243283 TATTCATGTCCACTTAAATGAGG - Intergenic
1046714140 8:117548740-117548762 TATACAGGTCCACTTACATGTGG + Intergenic
1049049988 8:140187135-140187157 TGTGCAGGTCCACTCATATGCGG + Intronic
1050620612 9:7448326-7448348 TGTACAGGTCCACTTATAAGTGG - Intergenic
1050975902 9:11937742-11937764 TCTTCAGGTCCACTTATATGTGG + Intergenic
1058959619 9:109980223-109980245 TATCCAGGGACACTGAGAAGAGG - Intronic
1059971760 9:119675727-119675749 CATTGTGGTACACTCAGAAGAGG + Intergenic
1061096514 9:128460315-128460337 GATTCTGGTCCACTCAAGAGAGG - Intronic
1061870541 9:133517990-133518012 ACTTCAGGTCCACTCCAAAGAGG + Intronic
1188538489 X:31223110-31223132 TATTCAGGTCAGCTGAAAAGAGG + Exonic
1196806288 X:119589798-119589820 AATTCAGGGCCGCTCAGCAGAGG - Exonic
1201236655 Y:11918510-11918532 TATTCAGCTCCAATCAGCTGAGG + Intergenic