ID: 1028649341

View in Genome Browser
Species Human (GRCh38)
Location 7:93133561-93133583
Sequence TCATCCACAAGGAGAAGCAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028649341 Original CRISPR TCATCCACAAGGAGAAGCAC AGG Exonic
900390888 1:2433330-2433352 TCATCCACATGGAGATGCCAGGG - Intronic
900785447 1:4646888-4646910 TCATCCCCAAGCAGCAGCTCTGG - Intergenic
905359775 1:37411256-37411278 TCAGCCACAGGGAGGGGCACTGG + Intergenic
905814917 1:40942228-40942250 TTATCCAAAAGGAAAACCACAGG - Intergenic
906877337 1:49553357-49553379 TCATCCACCATGAGAAGTCCTGG - Intronic
911231641 1:95368024-95368046 TCTTCCACAAGGAGAAGGAAAGG + Intergenic
913091313 1:115478606-115478628 TCCTCCACAAGGGCAAGCACAGG + Intergenic
914353430 1:146860292-146860314 TCATCAACAAGGAGGAGCAGGGG + Intergenic
916589241 1:166174404-166174426 TCATTCACTAGGAGATCCACTGG + Intergenic
917617640 1:176762328-176762350 CCATCCAGCAGGAGAAGCAAGGG - Intronic
922461595 1:225817657-225817679 ACTTCCCCCAGGAGAAGCACTGG + Intronic
923535902 1:234851662-234851684 TTATCCACAATCAGAAGCAGTGG + Intergenic
1065360050 10:24881105-24881127 TCATCCACATGGGAAAGCAGTGG + Intronic
1071325953 10:84518058-84518080 TCATCCCCAAGGAAAAACATCGG - Exonic
1072445027 10:95491658-95491680 TCCTCCACACAGAGAAGAACTGG + Intronic
1072448794 10:95522225-95522247 TCAGCAACAAGGAGAAGGAAAGG - Intronic
1073580806 10:104663975-104663997 TCATGGACAAGGAGAATGACAGG + Intronic
1073585604 10:104707082-104707104 TTATCCACAAGAAGGAGCAGTGG + Intronic
1073761001 10:106628691-106628713 TCATCCACAGATAGAAGCCCAGG + Intronic
1073808871 10:107130900-107130922 TCATCCCCAAACAGAAACACTGG + Intronic
1074511205 10:114113911-114113933 TCATCCACAAGGCAGTGCACGGG + Intergenic
1074710493 10:116173258-116173280 TCAGCCACCAGGAAAAGCAGTGG - Intronic
1075068439 10:119305111-119305133 CCAACCACAAGGTGAAGCTCAGG - Intronic
1076216273 10:128696136-128696158 CCAGCCACAGGGAGAAGCAGAGG + Intergenic
1076699931 10:132266282-132266304 GGATCCACAGTGAGAAGCACAGG + Intronic
1078528338 11:12117671-12117693 TCATCCAAAAGGAGCAGAATGGG + Intronic
1081460005 11:43263798-43263820 TCTTCCACAGGGAGAAGCTGAGG - Intergenic
1084660549 11:70544149-70544171 TCATCCCCAGGGAGAGGCACAGG - Intronic
1086346192 11:85899947-85899969 TCATCCACAAAGAGAACAAGAGG + Intronic
1087179688 11:95129364-95129386 ACATCCACAAGGACACGGACAGG - Exonic
1088378747 11:109170284-109170306 TAATCCTCAAGGAGAAGAAAAGG + Intergenic
1089919189 11:122191752-122191774 ACAGCCACATGGAAAAGCACTGG + Intergenic
1091663533 12:2401876-2401898 ACATCCACAATGAGAAGGAAGGG + Intronic
1094104228 12:26792835-26792857 ATATCCACATGGAGAAGCACTGG - Intronic
1096772517 12:53945114-53945136 TCATCACCAAAGAGAAGCGCCGG + Exonic
1097031482 12:56093345-56093367 TGATCAACAATGAGAAGCCCCGG - Exonic
1097812294 12:64032197-64032219 TCTTCCAGTGGGAGAAGCACTGG - Intronic
1098104383 12:67054078-67054100 TCATCCACAATGGGAAGACCAGG + Intergenic
1098556215 12:71821969-71821991 TGCTCCACATAGAGAAGCACTGG - Intergenic
1100090874 12:90969136-90969158 AAATCCACAAGGGGAAACACAGG + Intronic
1100871695 12:98916476-98916498 TCATTCACATGGAAATGCACTGG + Intronic
1101062815 12:100989443-100989465 TCATAAACAGGTAGAAGCACAGG - Intronic
1103018041 12:117511217-117511239 TGATCCACAAGGCCAGGCACTGG + Intronic
1104062876 12:125282687-125282709 ACATCCCCAAGCAGCAGCACCGG - Intronic
1104165012 12:126219569-126219591 TCATGCAAAAGGAAAAGCTCAGG + Intergenic
1104408885 12:128541836-128541858 TCACCCTCCAGGAGAAACACTGG - Intronic
1105604532 13:21915947-21915969 ACATCCACATGGAGATGGACAGG - Intergenic
1106402119 13:29441196-29441218 TCCCCCACCAGGAGAAGCCCAGG + Intronic
1107315526 13:39127481-39127503 TCAGCCACAAGCAGAGGAACTGG + Intergenic
1107630609 13:42338994-42339016 TCATTCACCAGGAAGAGCACGGG - Intergenic
1107677178 13:42809482-42809504 GCACCCACAAAGAGAAGTACTGG - Intergenic
1110868843 13:80426514-80426536 TCATGGACATGGAGAAGCACAGG - Intergenic
1113255114 13:108496908-108496930 TCTTCCAAAGGCAGAAGCACAGG + Intergenic
1114726571 14:24944084-24944106 TCCTCCACAAGAAGAGGCTCAGG + Intronic
1117098775 14:52324151-52324173 GCATCCACAAGAAGAGACACAGG + Intronic
1120379324 14:83754192-83754214 TCATCTACACAGAGAAGTACAGG + Intergenic
1121267407 14:92613235-92613257 CCTTCCACAAGGGGCAGCACAGG - Intronic
1122089177 14:99326804-99326826 TTATCCATAAGCAGAATCACTGG - Intergenic
1122945219 14:105005599-105005621 GCATCCAGAAGGCGAAGCATGGG + Intronic
1129522931 15:76197140-76197162 TCCTCTCCAAGGACAAGCACTGG - Intronic
1129824763 15:78627517-78627539 GCATTCTCAAGGAGAAGCGCTGG - Intronic
1131261476 15:90890234-90890256 TCATCCTGCAGGAGCAGCACAGG - Exonic
1133757707 16:8775026-8775048 TCTTCCACAAGGAGGAGTTCAGG + Exonic
1134910268 16:18019461-18019483 TCACCCAGAAAGACAAGCACTGG - Intergenic
1135833335 16:25798662-25798684 TCATCCACAAGGAAAGGGATAGG + Intronic
1138136278 16:54525764-54525786 TGTTCCAGAAGGAGAAACACAGG + Intergenic
1139213013 16:65099378-65099400 TCAATCACAAGGATAAACACAGG + Intronic
1139238582 16:65366806-65366828 TCATACTTAAAGAGAAGCACTGG + Intergenic
1139607319 16:68028796-68028818 TATTCCACAAGGAGAAGCTGAGG + Intronic
1139980592 16:70855226-70855248 TCATTAACAAGGAGGAGCAGGGG - Exonic
1140449465 16:75058829-75058851 TCATCCCCCAGGAGATGCGCTGG + Intronic
1141995125 16:87632029-87632051 TCAGACACAAGGAGAAGCCTTGG - Intronic
1142586831 17:979322-979344 TGCCCTACAAGGAGAAGCACAGG - Exonic
1142996205 17:3761951-3761973 CCATCCCCAAGGGGAGGCACCGG - Exonic
1143269456 17:5665099-5665121 TCACCCAAAAGGAGGAGCATCGG + Intergenic
1144527516 17:16002638-16002660 TAATCTGCAAGAAGAAGCACAGG - Intronic
1146514338 17:33477718-33477740 CCATTCACATGGAGAAGCTCAGG + Intronic
1148142482 17:45338496-45338518 TCATCCACTTGGAGAAAAACAGG + Intergenic
1149141279 17:53435972-53435994 CTACCCACAAGGAGAAGCACAGG + Intergenic
1149616495 17:58005455-58005477 TACTCCCCAAGGAGAAGCAGAGG - Exonic
1150840812 17:68603847-68603869 CCAGCAACAAGGAGAAGCTCAGG - Intergenic
1155387219 18:25291585-25291607 TCTTCCACCAGGAGAAATACAGG + Intronic
1155509705 18:26564163-26564185 TTTTGCACAAGGAGAAGGACTGG + Intronic
1156019632 18:32585233-32585255 TCATCCACCAAGAGAACAACAGG + Intergenic
1156032910 18:32733721-32733743 TCTCCCACAGGGAGAAGCAGGGG + Intronic
1160619076 18:80157939-80157961 TGGACCACAAGGAGAAGCAGCGG + Exonic
1161042305 19:2116653-2116675 TCTTCCACGAGGAGGAGCAGCGG - Exonic
1164604896 19:29590672-29590694 TCTCCCACAAGGAGTAGGACTGG + Intergenic
1166123402 19:40699423-40699445 CCAACCACAATGAGGAGCACAGG - Intronic
1166560796 19:43731329-43731351 TCCTCCACAGGGACAAGCAGTGG - Exonic
926164944 2:10515977-10515999 TATTCCAGAAGGAGAAGCAAGGG - Intergenic
926539876 2:14162770-14162792 TCATCCACATGAAAAAGCAAAGG + Intergenic
928008995 2:27590622-27590644 TAATCCAAAAGAAGAAACACAGG - Intronic
928826316 2:35425646-35425668 TCTTCAACAAAGAGATGCACGGG + Intergenic
929864594 2:45707570-45707592 TCTCCCAAAAGGACAAGCACAGG - Intronic
930047040 2:47181530-47181552 TGAGTCACAAGGAGAGGCACTGG - Intergenic
930118066 2:47736882-47736904 GAATCCAAGAGGAGAAGCACAGG - Intronic
931748869 2:65313789-65313811 TCAACCACGAGGAGAACCGCCGG - Exonic
932081567 2:68720464-68720486 TCATCCAAAAGGACAAGTTCTGG + Intronic
932286441 2:70536889-70536911 TCATCCACATGGGATAGCACAGG + Intronic
932563871 2:72893706-72893728 TCATCCACAAGGAGCTGGACTGG - Intergenic
934875376 2:97914181-97914203 ACATACACACAGAGAAGCACAGG - Intronic
939017204 2:136916641-136916663 TCATACACAGGGAGAAGCAGCGG - Intronic
940287819 2:152049739-152049761 TCTTCCACATGGAGCAGCAAGGG + Intronic
942758932 2:179375219-179375241 TCATCCTTAAGAAAAAGCACTGG + Intergenic
944611617 2:201414557-201414579 TCACCCAGAAGGAGAAGCAGTGG + Intronic
945024061 2:205603732-205603754 TCATGCACAAGGACACACACAGG - Intronic
947898697 2:233700340-233700362 TCAGCCATAAAGATAAGCACAGG - Intronic
948451346 2:238075503-238075525 TTCTCCACAAAGAGAAGCCCAGG - Intronic
948617620 2:239211364-239211386 TCGGCCCCCAGGAGAAGCACGGG - Intronic
949057020 2:241933195-241933217 TCCTCCACCCGGAGGAGCACAGG + Intergenic
1169037658 20:2466877-2466899 TCAGCCCCAAGGAGAATCAAAGG + Intronic
1169863637 20:10176664-10176686 TCATTCACAAGGAGAAGAGAAGG - Intergenic
1170359502 20:15529156-15529178 TCAGCCAAAAGGAGAAGAGCTGG + Intronic
1173135791 20:40437810-40437832 GTATCCACTAGGAGAAGCATGGG + Intergenic
1173352163 20:42255050-42255072 TCATCAACAAGGACAAGAGCTGG + Intronic
1174061569 20:47836638-47836660 TCTTCCACAAGGAACAGCATTGG - Intergenic
1174069957 20:47892687-47892709 TCTTCCACAAGGAACAGCATTGG + Intergenic
1175313753 20:58031019-58031041 TCTCCCAGAAGGGGAAGCACAGG + Intergenic
1176408030 21:6432216-6432238 TCACCCACCAGGATAGGCACTGG - Intergenic
1178042355 21:28653124-28653146 TGCTCCACAAGGAGCAGTACTGG + Intergenic
1179089648 21:38252866-38252888 TAATACACACAGAGAAGCACAGG - Intronic
1179683521 21:43040542-43040564 TCACCCACCAGGATAGGCACTGG - Intergenic
1181440490 22:22933035-22933057 TCCTCCACATGGAGAAAGACAGG - Intergenic
1181589621 22:23876143-23876165 GCATGCACAAGGAGAAGTCCAGG + Intronic
1182765449 22:32754824-32754846 CCACCCACCAGGAAAAGCACAGG - Intronic
949299730 3:2569979-2570001 CCAGACACAAGGTGAAGCACTGG - Intronic
949943185 3:9170607-9170629 TCATTCACAATCAGAACCACCGG - Intronic
951156382 3:19358946-19358968 TAATCCACAAGGAAAAGGAAAGG + Intronic
953447662 3:42981283-42981305 TCATTCAGATGGAGAAGCAAAGG - Intronic
956129153 3:66038276-66038298 TGATCCAGAAGAAGAACCACTGG - Exonic
956866809 3:73377122-73377144 TCATCCACCAGGAAACACACAGG - Intergenic
957220792 3:77379968-77379990 TTATCCCCAGGGAGAAGCAAAGG + Intronic
958917972 3:100070929-100070951 TCATACACAAAGAAAACCACAGG - Intronic
959650245 3:108744253-108744275 GGAGCCACACGGAGAAGCACTGG - Intronic
961104479 3:124229492-124229514 TTATCTACAAGGAGTAGCAGTGG + Intronic
961749224 3:129085821-129085843 GCAGCCACAAGGAGATGCCCAGG + Intergenic
970851595 4:20610203-20610225 TCGTCCATAATGAGAATCACAGG - Intronic
971159402 4:24118388-24118410 AACTCCACAAGGAGATGCACAGG - Intergenic
974619059 4:64332227-64332249 TTATGCACAAAGAGAAGCCCTGG + Intronic
984273332 4:177574993-177575015 TCATACTCAAGGAGAAGCACAGG + Intergenic
985804663 5:2033664-2033686 TCATTCCCAAGGAGCAGGACTGG - Intergenic
985889093 5:2701811-2701833 TCATCCACCAGCAGAGGCAGAGG + Intergenic
986214801 5:5709539-5709561 GCAGCCACATGGAGAAGCCCAGG + Intergenic
992142655 5:73814713-73814735 TCCTCCTCTGGGAGAAGCACAGG - Intronic
996023334 5:118615713-118615735 TCATTACCAAGGAGAAGTACAGG - Intergenic
998950349 5:147387502-147387524 TCAGCCACAAGCAGCAACACTGG - Exonic
999765519 5:154737811-154737833 TCATTCACAAGGAGGGGCAGGGG - Intronic
1000384958 5:160666493-160666515 TAAGCCCCAAGGAGAAGGACAGG - Intronic
1001447592 5:171797773-171797795 TCAGCCACAAGGACTAGCTCAGG - Intergenic
1002395665 5:178951454-178951476 AAACCCACAAAGAGAAGCACAGG - Intronic
1004517565 6:16333575-16333597 TCATTCAAACTGAGAAGCACAGG - Intronic
1004649223 6:17592530-17592552 TCAACCACTTGGAGAAGCAAAGG + Intergenic
1006918636 6:37613307-37613329 TCATCCACCATGAGAGTCACAGG + Intergenic
1007244651 6:40452060-40452082 TCCTACACAAGGAGAAACAAAGG + Intronic
1007363924 6:41376628-41376650 TTATGCACAAGGAGAAACAGAGG - Intergenic
1007893623 6:45322840-45322862 TCATCCAAAAGCAGTGGCACTGG + Intronic
1008639401 6:53446067-53446089 GTATCCACTTGGAGAAGCACAGG - Intergenic
1008967832 6:57331526-57331548 TGACCCACAAAGAGAAGCCCAGG - Intronic
1010591007 6:77712021-77712043 TCATCTACAAGGTGAATCAATGG - Intronic
1012638162 6:101573511-101573533 TCCTCCAGAAGGAAAAGAACTGG - Intronic
1016300480 6:142624968-142624990 TTATCCACAATGAGTAGAACCGG + Intergenic
1016583176 6:145652725-145652747 TAATCTACAAGCAGAAACACAGG + Intronic
1016892128 6:149016995-149017017 GCATCCTCAAGGCAAAGCACAGG + Intronic
1017859256 6:158379941-158379963 TCATCCACTAGGGCAACCACTGG - Intronic
1017948847 6:159118515-159118537 GCGTCCACAAGGAGAGCCACTGG - Intergenic
1019488884 7:1301879-1301901 TCATCCAGAAGGAGAAACCGAGG - Intergenic
1021932997 7:25600101-25600123 TCATCCAAAAGGAGGAACAAAGG + Intergenic
1023568469 7:41548475-41548497 TCATCCCCAAGGAGAAGGTTAGG + Intergenic
1023829308 7:44029619-44029641 TCCCCCACAGGGAGAGGCACCGG - Intergenic
1023937053 7:44748156-44748178 TTTTCCAGAAGGAGAACCACTGG + Intergenic
1025232875 7:57214438-57214460 TCTTCCACAAGGAACAGCATTGG + Intergenic
1025723853 7:64040012-64040034 TCATGCACAAGACGAAACACAGG - Intronic
1026063335 7:67046266-67046288 TCAACCACAAGCAGAACCAAAGG - Intronic
1026715008 7:72781231-72781253 TCAACCACAAGCAGAACCAAAGG + Intronic
1027222516 7:76223135-76223157 AAATGCAGAAGGAGAAGCACTGG - Intronic
1028646523 7:93103699-93103721 TCATCAACAAGGAGTAGTACAGG + Exonic
1028649341 7:93133561-93133583 TCATCCACAAGGAGAAGCACAGG + Exonic
1029739614 7:102483877-102483899 TCCCCCACAGGGAGAGGCACCGG - Exonic
1029757615 7:102583056-102583078 TCCCCCACAGGGAGAGGCACCGG - Exonic
1029775552 7:102682117-102682139 TCCCCCACAGGGAGAGGCACCGG - Intergenic
1030715413 7:112802444-112802466 GCTACCACAAGGAGAAGCTCAGG - Intergenic
1031464278 7:122089351-122089373 TCATCCACAAGAGGAAACGCAGG + Intronic
1031588311 7:123559329-123559351 CTATCCAGAAGGAAAAGCACAGG + Intergenic
1032987622 7:137356369-137356391 TGCTCCACAAGGAGCAGCACTGG - Intergenic
1034109994 7:148527539-148527561 TCATCCACAAAGAGCAGCTCTGG - Intergenic
1036986147 8:13533165-13533187 TAATCCATAAAGAGAAACACTGG + Intergenic
1038998539 8:32953324-32953346 TCATCACCACTGAGAAGCACAGG - Intergenic
1039466130 8:37786662-37786684 TCACCCAGAAGGAGAAGGCCAGG - Intronic
1039627998 8:39075436-39075458 TCATCCATAAAGTGAAACACTGG - Intronic
1041997430 8:64080303-64080325 ACTTCCACAGGGAGAGGCACTGG - Intergenic
1042632550 8:70835100-70835122 TCAACCACAAGGAGGAGCTGTGG + Intergenic
1042651212 8:71043439-71043461 CCATCCACAAGGTAAAGCACAGG + Intergenic
1044139854 8:88636944-88636966 TCATCCAAGAGAAGAAACACAGG - Intergenic
1048551824 8:135440567-135440589 TCTTCCTCAGAGAGAAGCACAGG + Intergenic
1048643165 8:136387353-136387375 TCACAAACAAGGAGAAGCAGAGG - Intergenic
1050350446 9:4736343-4736365 ACATACACAAAGAGAAGCATAGG + Intronic
1051026770 9:12622625-12622647 TAAATCACAAGAAGAAGCACTGG + Intergenic
1055120941 9:72660028-72660050 TCCTCCTCAAGGAGAAGGACAGG - Intronic
1055426679 9:76203948-76203970 TCATCCAAATGGGGAAGCAGGGG - Intronic
1056419419 9:86409349-86409371 GCAGACACAAGGAGAAGCATGGG + Intergenic
1058840079 9:108897965-108897987 TGATATACAAGGAGAAGTACAGG + Intronic
1061267756 9:129517392-129517414 TCATCTATAAGGAAAAGCAAAGG - Intergenic
1061408977 9:130408102-130408124 TCATCCACCAGGAGTAGCACAGG + Intronic
1061611645 9:131750469-131750491 TCATGCAGAAGGAGCAGCATTGG + Intergenic
1062630459 9:137460952-137460974 TCTTCCACAAGGACAAGGAGCGG + Intronic
1062701551 9:137908145-137908167 ACATCCACATGGACAAGCAATGG - Intronic
1186234032 X:7487973-7487995 TCACCAGCAAGGAGAAGTACTGG + Intergenic
1189304725 X:39978383-39978405 TCACCCAAAAGGAGAGGAACAGG - Intergenic
1190496277 X:51031174-51031196 GCAGCCACAAGGAAAAGCAAGGG - Intergenic
1192247812 X:69388012-69388034 TCACCCACCAGGACAAGCACAGG - Intergenic
1195033282 X:100947323-100947345 TCATACACAAGGAAAATCAGTGG - Intergenic
1198459981 X:136853815-136853837 TGATCAACACGGAGAAACACTGG + Intronic
1199422899 X:147666409-147666431 TGATCCAAAAGGAGAAGCTGAGG + Intergenic