ID: 1028649666

View in Genome Browser
Species Human (GRCh38)
Location 7:93137616-93137638
Sequence CAATTTTTCCACAGGGTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 6, 3: 42, 4: 301}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028649666_1028649675 16 Left 1028649666 7:93137616-93137638 CCCACTACCCTGTGGAAAAATTG 0: 1
1: 0
2: 6
3: 42
4: 301
Right 1028649675 7:93137655-93137677 TCCCTGGTTCCAAAAAGATTGGG No data
1028649666_1028649674 15 Left 1028649666 7:93137616-93137638 CCCACTACCCTGTGGAAAAATTG 0: 1
1: 0
2: 6
3: 42
4: 301
Right 1028649674 7:93137654-93137676 GTCCCTGGTTCCAAAAAGATTGG No data
1028649666_1028649671 0 Left 1028649666 7:93137616-93137638 CCCACTACCCTGTGGAAAAATTG 0: 1
1: 0
2: 6
3: 42
4: 301
Right 1028649671 7:93137639-93137661 TCTCCCATGAAGCTGGTCCCTGG No data
1028649666_1028649670 -7 Left 1028649666 7:93137616-93137638 CCCACTACCCTGTGGAAAAATTG 0: 1
1: 0
2: 6
3: 42
4: 301
Right 1028649670 7:93137632-93137654 AAAATTGTCTCCCATGAAGCTGG No data
1028649666_1028649677 17 Left 1028649666 7:93137616-93137638 CCCACTACCCTGTGGAAAAATTG 0: 1
1: 0
2: 6
3: 42
4: 301
Right 1028649677 7:93137656-93137678 CCCTGGTTCCAAAAAGATTGGGG 0: 2
1: 97
2: 1301
3: 1734
4: 1320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028649666 Original CRISPR CAATTTTTCCACAGGGTAGT GGG (reversed) Intronic
901097912 1:6697367-6697389 TAATTTTTCCACAGACTAGTGGG + Intronic
901765487 1:11497216-11497238 AAATTTTTCCATAGGTTATTGGG + Intronic
902803873 1:18848966-18848988 CAATTTTTCCACAGACTGGGAGG - Intronic
905545642 1:38797394-38797416 CATTTTTTCTACTGGGTTGTTGG - Intergenic
905689916 1:39935466-39935488 CATTTTTTGCACAGGATAGGTGG + Intergenic
907017557 1:51032118-51032140 CAATTTTTCCGCAGGGCGGGGGG + Intergenic
907934798 1:59032624-59032646 CAATAGCTCCACAGGGTTGTTGG + Intergenic
909005423 1:70270490-70270512 TAATTTTTCCACAGACTGGTGGG + Intronic
909592406 1:77365526-77365548 CAATTTTTCCATGGGGTTGGGGG + Intronic
911164429 1:94712349-94712371 CAATTTTTCAACAGGTTGGAGGG - Intergenic
911250216 1:95568144-95568166 CAATTTTTCCACAGTGTGGGAGG + Intergenic
911320359 1:96406703-96406725 CATTTTTTCCACATGTTTGTTGG - Intergenic
911353198 1:96781276-96781298 TTATTTTTCCACAGAGTACTAGG + Intronic
911365101 1:96928604-96928626 CAATTTTTTCACAGGTTGGGGGG - Intergenic
912227450 1:107751026-107751048 CAATTTTTCCAGTGTGAAGTAGG - Intronic
913275509 1:117134233-117134255 AAATTTTTCCAAATGATAGTTGG + Intergenic
913657085 1:120971620-120971642 CAATTTTTCCACAGACAAGGTGG + Intergenic
914008429 1:143754703-143754725 CAATTTTTCCACAGACAAGGTGG + Intergenic
914521648 1:148422874-148422896 CAATTTTTCCACAGACAAGGTGG + Intergenic
916629301 1:166594434-166594456 CAATTTTTCCACTGACTGGTGGG + Intergenic
916629911 1:166601222-166601244 CAGTTTTTCCACAGACTGGTAGG + Intergenic
917042642 1:170823170-170823192 CAATTTTTCTATAGAGTAGCAGG - Intergenic
917348727 1:174055911-174055933 CAAAGCTTCCACAGGGTAGAAGG + Intergenic
917701299 1:177584248-177584270 CAATTTTACCATAGGCAAGTGGG - Intergenic
918287990 1:183077418-183077440 TAATTTTTCCATAGGTTATTGGG + Intronic
918613883 1:186522772-186522794 CACTTTTTCCACAAGGCAGCAGG - Intergenic
918873966 1:190014082-190014104 CAATTTTTCCATAAGTTATTGGG - Intergenic
919962029 1:202480953-202480975 CAATTTTTCCACAGACTGGTGGG + Intronic
920572024 1:207024610-207024632 GAATTTTTCCACAGGAGAATGGG + Intronic
921123520 1:212157241-212157263 CAATTTTACCATAGGCTAATGGG - Intergenic
921242060 1:213194858-213194880 CAACTCTTCCACAGACTAGTGGG - Intronic
921812067 1:219526528-219526550 CAATTATTACACAGGATGGTGGG + Intergenic
922568943 1:226620958-226620980 CAATTTTTCCAGAAAGTAGAAGG - Intergenic
923833693 1:237585957-237585979 CAATTTTTTCTCTGTGTAGTGGG - Intronic
923841475 1:237676411-237676433 CATTCTATCCACAGGGTAGAGGG + Intronic
924576979 1:245289707-245289729 CAATTTTTCTGCAGGAGAGTTGG + Intronic
1063698159 10:8357491-8357513 CAATTTTGCCACGGGGCAGGGGG + Intergenic
1065505849 10:26429474-26429496 CAATTTTTCCACAGATTGGTGGG - Intergenic
1065875452 10:29993700-29993722 CATTCTTTCCACAGGAGAGTGGG + Intergenic
1065972971 10:30819463-30819485 CCACTTTTCCACAGGGTGCTTGG + Intergenic
1071117846 10:82244661-82244683 CAATTTTTTCACAGGCCAGGGGG + Intronic
1072675542 10:97463144-97463166 AAACTGTTTCACAGGGTAGTTGG - Intronic
1073048912 10:100655572-100655594 GAATTTTTCCACTGGGAATTGGG - Intergenic
1073585573 10:104706670-104706692 AAATTTATCCACAGGGAAGTGGG - Intronic
1073803641 10:107071400-107071422 CAACTTTTACACAGAGTTGTGGG + Intronic
1074581534 10:114723855-114723877 TGATTTTTCCACAGGGTAGGAGG - Intergenic
1075630689 10:123999024-123999046 CAGTTTTTCCACAGTTTGGTGGG + Intergenic
1075880599 10:125847582-125847604 CAATTTTTCCACAGACCAGAGGG + Intronic
1076063731 10:127432104-127432126 CAATTTTTCCACAGACCAGCAGG - Intronic
1079715718 11:23741235-23741257 CAATTTTTTCAAAGATTAGTTGG + Intergenic
1080244539 11:30164501-30164523 CAATTTTTCCACAGACCAGGTGG + Intergenic
1080466495 11:32502373-32502395 CAATTTTTCCACAGACCAGGGGG - Intergenic
1080752378 11:35162659-35162681 CAATTAGTTCACAGGGCAGTTGG + Intronic
1085719304 11:78899028-78899050 CACTTTTTCCACTGAGAAGTGGG + Intronic
1086475794 11:87171774-87171796 CAATTTTTCCACGGGGGGCTTGG + Intronic
1086616289 11:88824493-88824515 CAATTTTTCCACAGGACAGTGGG + Intronic
1087543048 11:99545356-99545378 CAATTTTTCCAAGGGGATGTGGG + Intronic
1090704824 11:129326686-129326708 CAATTTTTCCACAGACCAGGGGG + Intergenic
1093104452 12:15069102-15069124 CAATTTTTCCACAGACCAGGGGG - Intergenic
1093408706 12:18839215-18839237 AAATTTTTCCATAGGTTATTGGG + Intergenic
1093993500 12:25616193-25616215 CTATTTTTAGACAGGGTGGTAGG + Intronic
1095323868 12:40863793-40863815 CAATTTTTCCACAGATGAGAAGG - Intronic
1098125740 12:67291020-67291042 CAATTTTTCCACAGATTTGCAGG - Intronic
1098326260 12:69305843-69305865 CATTTTTTTCATAGGGTTGTTGG + Intergenic
1099438317 12:82669603-82669625 CAAATTTTCCACAGACCAGTCGG + Intergenic
1099863533 12:88249351-88249373 CAATTTTTCCACAGACGGGTTGG - Intergenic
1099868766 12:88319660-88319682 CAATTTTTTCACAGACTGGTGGG - Intergenic
1100028935 12:90162691-90162713 CAACTTTGCCACTGGGTAATGGG - Intergenic
1100424340 12:94469392-94469414 CAATTTTTCCACAGATTGATGGG + Intergenic
1103281252 12:119759728-119759750 CAATTTTTCCACAGGGGTGGGGG - Intronic
1105669805 13:22600590-22600612 CAATTTTTCCACAGACTGGGCGG + Intergenic
1105782808 13:23719277-23719299 CAATTTGCCCACAGTTTAGTGGG + Intergenic
1106155331 13:27149756-27149778 CAATTTTTCCATGGACTAGTGGG + Intronic
1106304497 13:28497300-28497322 CAACTTTTCAAAAGAGTAGTTGG - Intergenic
1108174746 13:47780648-47780670 CAATCTGTCCATAGGGTAGGGGG + Intergenic
1108267392 13:48725915-48725937 TTATTTTTCCATAGGGTATTGGG - Intergenic
1109227330 13:59712858-59712880 CAATTTTTCCACAGGGGTGAGGG + Intronic
1110056321 13:70977628-70977650 CAATTTCTTCACAGAGTATTTGG + Intergenic
1111460643 13:88537030-88537052 CAGTTTTTCCACAGAGAAGGCGG + Intergenic
1112747787 13:102546877-102546899 AAATTTTTCCATAGGTTATTGGG - Intergenic
1112747819 13:102547200-102547222 AAATTTTTCCATAGGTTATTGGG - Intergenic
1113135068 13:107080070-107080092 AAATGCTTCCACAGTGTAGTTGG + Intergenic
1113918497 13:113889440-113889462 CAATTTTTCCACAGACCAGAGGG - Intergenic
1114458891 14:22874491-22874513 CAATTTTTCCAAAGGGCTCTAGG + Intronic
1115060263 14:29179585-29179607 CATTTTTTCCACACATTAGTTGG + Intergenic
1116255574 14:42549895-42549917 CAATTTTTCCACAGACTGGTGGG - Intergenic
1116634308 14:47375914-47375936 CAAGTTTTCCACATGGTAATAGG - Intronic
1117281143 14:54242259-54242281 CAATTTTTCCACAGACTGGCAGG + Intergenic
1118866468 14:69708328-69708350 TAGTTTTTCCACAGGGTAAAAGG + Intronic
1119913158 14:78369836-78369858 CACTTTTTCCACAGTGTCTTTGG - Intronic
1120479576 14:85033493-85033515 CAATTTTTCCACAGACCAGAGGG + Intergenic
1121885057 14:97535377-97535399 CAGAGATTCCACAGGGTAGTGGG + Intergenic
1122615927 14:103017991-103018013 CAATTTTTCCACAGACCCGTAGG + Intronic
1123634126 15:22286181-22286203 CCATGCTTCCACAGGGTAGGTGG + Intergenic
1124571854 15:30871719-30871741 CATTTATTCCAGAAGGTAGTGGG - Intergenic
1124668372 15:31614283-31614305 CTATTTTTCCATAGGTTATTGGG - Intronic
1124842512 15:33256876-33256898 CAATTTTTCCACGGGGTGCAAGG + Intergenic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1125993315 15:44131866-44131888 CAATTTTTCCACAGGTGGGCGGG + Intronic
1126037983 15:44565328-44565350 CAATTTTTCCACAGACTGGGAGG + Intronic
1126646918 15:50883848-50883870 CAATTTTTCCACAGACTGGAAGG - Intergenic
1127130627 15:55858637-55858659 TCATTTTTTCACAGGGGAGTGGG - Intronic
1130629661 15:85553956-85553978 CAATTTTTCCACAGATGAGGGGG - Intronic
1131761821 15:95631726-95631748 AAATTTTCCCACAGGGTACATGG - Intergenic
1132076518 15:98825634-98825656 CAATTTTTCCACAGATGGGTGGG - Intronic
1132215047 15:100056413-100056435 CAATTTTTCCACAGACCAGGGGG + Intronic
1133595002 16:7282590-7282612 AAATTTTTCCATAGGTTATTGGG + Intronic
1134080355 16:11320627-11320649 CAATTTTTCCATGGACTAGTGGG - Intronic
1135898313 16:26430783-26430805 TAATTTTTCCATAGGTTATTGGG - Intergenic
1138420458 16:56895674-56895696 CAATTTTTCCACAGGCTTGGGGG + Intronic
1138523710 16:57589363-57589385 CAATTTTTCCACAGATTCGGGGG - Intronic
1138688386 16:58746574-58746596 AAATCTTTCCAAAGGGTGGTAGG + Intergenic
1138964721 16:62070555-62070577 AAATTTTTTCACAGGCTTGTGGG + Intergenic
1138999474 16:62492113-62492135 CTATTTTCCCACAGGGATGTAGG + Intergenic
1141863979 16:86737092-86737114 CAAGTTTTCCACAGGGCCATGGG - Intergenic
1143241750 17:5449345-5449367 CCATTTTTCTACTGGGTCGTTGG - Intronic
1144371984 17:14599829-14599851 CAGTTTTTTCACAGTGTTGTTGG - Intergenic
1146583904 17:34065491-34065513 AAATTTTTCCACAAGTTATTGGG - Intronic
1146874793 17:36400512-36400534 CAAAGTTTCCACAGGGGAGAGGG - Intronic
1147064594 17:37912367-37912389 CAAAGTTTCCACAGGGGAGAGGG + Intergenic
1147715724 17:42506846-42506868 CAATTCTTCCACAGGCACGTGGG - Intronic
1149485038 17:57036084-57036106 CAATTTGTCCAGAGGGCACTTGG - Intergenic
1150168990 17:62971902-62971924 CAATTTTTCCAGAGGGTAGGGGG - Intergenic
1150981115 17:70142602-70142624 CTGTGTTTCCACAGGGTAGAAGG - Intergenic
1151032107 17:70753328-70753350 CAATTTTTCCATGGGGTTGGGGG - Intergenic
1151378594 17:73708977-73708999 CATTTTCTCCAGAGGGAAGTTGG - Intergenic
1151915122 17:77112150-77112172 CACTTTCTTCACAGGGCAGTAGG - Intronic
1153663380 18:7346062-7346084 AAATTTTTCCATAGGTTATTGGG + Intergenic
1154222151 18:12465505-12465527 CACTTTTTCCATAGGGTTATTGG + Intronic
1155978283 18:32155267-32155289 CAATTTTACCATAGGCTAATTGG - Intronic
1156614311 18:38765286-38765308 AAATTTTTCCACAGGTTATTGGG - Intergenic
1157375622 18:47161686-47161708 CAATTTTTCCACAGATGGGTTGG + Intronic
1157904642 18:51558711-51558733 CAATTTTTCCACAGATTTGAGGG - Intergenic
1158105795 18:53883664-53883686 CACTTTTTCCTCAGAATAGTTGG + Intergenic
1158346048 18:56518145-56518167 AAATTTTTCCAAAGGGCAGATGG - Intergenic
1158778287 18:60614477-60614499 CAGTTTTTCCACAGGGCAGGGGG - Intergenic
1158885377 18:61821910-61821932 CAATTTTTCCACAGGACGGATGG - Intronic
1159285347 18:66342624-66342646 CAATTTTTCCACAGAATGGTGGG + Intergenic
1159377758 18:67615667-67615689 CACTTTTTTCACAGGGTGGGAGG - Intergenic
1159563772 18:70024714-70024736 CAAATTTTCCAAATGGTAATAGG - Exonic
1159863402 18:73675582-73675604 CGATTTTTCCCAAGGGCAGTGGG - Intergenic
1168521876 19:57057749-57057771 GATTCTTTCCACAAGGTAGTGGG + Intergenic
929184532 2:39079905-39079927 CAATTTTTCCACAGACTAGGAGG + Intronic
929239934 2:39643601-39643623 CAATTTTTACACAGGACAGGGGG - Intergenic
930422767 2:51175148-51175170 CAATTTTTCCACAGACTGGTGGG - Intergenic
932783343 2:74577924-74577946 CAATTTTTCCATGGGGTGGTGGG + Intronic
932862389 2:75307595-75307617 TAATTTTTCCAGAGGGAAATTGG + Intergenic
935414818 2:102804167-102804189 CAATTTTTCCATAGGTTATTGGG + Intronic
936249381 2:110855875-110855897 CAAAGTTTCCACAGGGTGGAAGG + Intronic
937582920 2:123511225-123511247 CAATTTTTCCATAGACTAATTGG + Intergenic
937610430 2:123855043-123855065 CATTTTTTCAACATAGTAGTAGG + Intergenic
938706574 2:133935284-133935306 CAAATTTCCCACAGTGTAGAGGG + Intergenic
938904803 2:135827543-135827565 CAATTTTTCCACAGACTTGGGGG + Intronic
939987556 2:148845805-148845827 TAATTTTTCCACATGGTGTTAGG + Intergenic
940341036 2:152581678-152581700 CTGCTTTCCCACAGGGTAGTGGG + Intronic
940534005 2:154915210-154915232 CAAAGTTTCTACAGGGCAGTAGG + Intergenic
940558352 2:155261897-155261919 CAATTATGCCACAGAGTATTAGG + Intergenic
940986769 2:160058817-160058839 CAAATTTTCCACAGGCCAATGGG + Intronic
942060258 2:172222808-172222830 TTATTTTTCCACAGGTTATTGGG - Intergenic
943270955 2:185803203-185803225 AAAATATTCCACAGGGTAGTAGG + Exonic
943776572 2:191772946-191772968 CAATTTTTCCACAGAGGAGTGGG - Intergenic
944161194 2:196662369-196662391 CAGTTTTTCCATGGGGTTGTGGG + Intronic
945013358 2:205488246-205488268 CAATTTTTCCACAGGGCGGGGGG + Intronic
946440015 2:219687142-219687164 GAATTTTTCCAAAGGCTAATGGG - Intergenic
946682855 2:222235550-222235572 CAATTTTTTCAGAGGATTGTGGG + Intronic
946779337 2:223176787-223176809 CAATTTTTCCACAGGATCAGCGG - Intronic
947230269 2:227877598-227877620 CAATTTTTCCACAGACCAGGGGG + Intronic
1168976295 20:1968635-1968657 CAATTTTGCCACACGGAGGTGGG - Intergenic
1168977388 20:1977630-1977652 CAATTTTGGCACAGGGTAGGTGG + Intergenic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1172055362 20:32150786-32150808 CCATTTTCCCACAGGGTGTTTGG + Exonic
1173095590 20:40025079-40025101 CAATTTTTCCACAGTGTGGGGGG + Intergenic
1173864404 20:46305218-46305240 CAACTTTTCATCAGGGCAGTGGG - Intronic
1174167018 20:48592346-48592368 CAATTTTTCCACAGACCAGGGGG + Intergenic
1177032863 21:16004409-16004431 CAATCTTCCCACAGGCTACTTGG + Intergenic
1177612366 21:23468187-23468209 AAATTTTTCCACAAGTTATTGGG - Intergenic
1181575209 22:23789828-23789850 CCTGTTTTCCACAGGGCAGTGGG - Intronic
1182120197 22:27781493-27781515 CACCCTTCCCACAGGGTAGTGGG - Intronic
1182560230 22:31153740-31153762 CAGTTCTTCCACAGAGGAGTGGG - Intergenic
1184322060 22:43749437-43749459 CAATTTTTCCATGGGCCAGTGGG + Intronic
1184629718 22:45766427-45766449 CAATTTTTCCACAGACTCGGGGG - Intronic
951336865 3:21434191-21434213 CAATTGTTCAACTTGGTAGTTGG + Intronic
952643842 3:35631659-35631681 CAATTTTTCCACAGGGGATAGGG - Intergenic
953255375 3:41285722-41285744 TAATTTTTCCATAGGTTATTGGG - Intronic
953613787 3:44471439-44471461 GACTTTGTGCACAGGGTAGTGGG - Intronic
956315684 3:67933956-67933978 CAATTTTTCCACAGATGGGTTGG + Intergenic
956392044 3:68784668-68784690 CAAAGTTTCCACAGGGTGGAAGG + Intronic
956640662 3:71412553-71412575 CATTTTCTTCAAAGGGTAGTTGG - Intronic
956950776 3:74279773-74279795 TTATTTTTCCATAGGTTAGTGGG - Intronic
957160666 3:76605568-76605590 GAATTTTTCCATAGGAAAGTTGG + Intronic
957292134 3:78291718-78291740 CAATTTTCCCATAGGTTAATTGG + Intergenic
958040593 3:88221675-88221697 AAATCTTTCCACAGTGGAGTGGG + Intergenic
958056510 3:88419231-88419253 CAATTTTTCCACAGACCAGGGGG - Intergenic
958411496 3:93822253-93822275 CAATTTTTCCACAGATTGCTTGG + Intergenic
958482672 3:94663401-94663423 AAATTTTTCCACTGAGAAGTTGG + Intergenic
958969393 3:100594742-100594764 TAATTTTTCCATAGGTTATTGGG + Intergenic
959669344 3:108957423-108957445 CAATTTTTCTACTTGGTGGTGGG - Intergenic
962519692 3:136186829-136186851 CTATTTTTCCACAGGGTCAGGGG - Intronic
963100828 3:141602265-141602287 CAATTTTTCCACGGACTGGTGGG + Intronic
965569855 3:170161404-170161426 CAATTTTTCCACAGAGAAGGTGG + Intronic
965880173 3:173379792-173379814 CAATTTTGCCAAAGGTCAGTTGG + Intergenic
966127727 3:176599665-176599687 TAATTTTGGCACTGGGTAGTTGG - Intergenic
966576873 3:181511978-181512000 CTATTTTACCACAGTGTATTTGG - Intergenic
967358119 3:188596392-188596414 CACTTTTGCCACAGAGTAGGAGG - Intronic
967671419 3:192239766-192239788 CAATTTTTCCACAGACTAGTTGG - Intronic
968220064 3:196930646-196930668 CAATTTTTCCACAGACTTGGGGG - Intronic
968257163 3:197286329-197286351 CAATTTTTCCACAGAAAAGAGGG + Intronic
968855784 4:3120718-3120740 CAATTTTTCCACAGGGCCAGGGG - Intronic
970038677 4:11770884-11770906 CAATCTTTCCACAGACTTGTGGG - Intergenic
970371574 4:15412329-15412351 CAATTTTCCCACAGACTGGTGGG - Intronic
970514151 4:16810939-16810961 CAATTTTTCCACAGACTGGTGGG + Intronic
970970353 4:21975907-21975929 GAATTTTTCCACAGGAAAGTGGG + Intergenic
971121760 4:23712348-23712370 CAATTTTTCCACAGATTGGAGGG - Intergenic
972431714 4:38989471-38989493 CCCTCTTTCCACAGGGTAATAGG + Intronic
972916171 4:43882805-43882827 CACTTTTTCCATGGGGTGGTGGG - Intergenic
972975722 4:44633162-44633184 CAATTTTTCCACAGCCAGGTTGG - Intronic
973145458 4:46820034-46820056 CAATTTTTTCACAGACCAGTCGG + Intronic
976231882 4:82852840-82852862 CAATTTTTCCACAGGCCAGCAGG + Intronic
976787216 4:88835451-88835473 CAACTTTTCCACAGACTAGGGGG + Intronic
976845424 4:89483625-89483647 CAATTTTTCCACAGGCCAGCAGG - Intergenic
976942409 4:90719468-90719490 CAATTTTTCCACAAAGTGGGAGG - Intronic
977001633 4:91511913-91511935 CAATTTTTCCACAGACCACTGGG - Intronic
977452172 4:97212561-97212583 CAGTTTTACCACAGGCTAATTGG - Intronic
979264646 4:118687094-118687116 CAGTGTTTGCACAGGGTTGTGGG - Intronic
979557446 4:122065786-122065808 CAATTTTTCCACGGACGAGTGGG + Intergenic
979638718 4:122986729-122986751 TAATTTTTCCACAAGTTATTGGG - Intronic
979746134 4:124215436-124215458 CAAGGTTTCCACATAGTAGTAGG - Intergenic
980167021 4:129241274-129241296 TAATTTTCCCACATGGTAATAGG + Intergenic
980675936 4:136080781-136080803 CAGCTTTTTCACAGGGCAGTAGG + Intergenic
981209726 4:142088832-142088854 CAAAATTTCCACAGTCTAGTAGG + Intronic
981364693 4:143888867-143888889 CAATTTTTCTAAATTGTAGTTGG - Intronic
981375192 4:144007138-144007160 CAATTTTTCTAAATTGTAGTTGG - Intronic
981385807 4:144129339-144129361 CAATTTTTCTAAATTGTAGTTGG - Intronic
981980008 4:150780792-150780814 CAATTTTTCCACAGACAAGGGGG + Intronic
982164778 4:152604653-152604675 CAATTTTTCCACGAGGCAGAGGG - Intergenic
983312106 4:166077804-166077826 AAATCTTTCAACAGGGCAGTGGG + Intronic
983439734 4:167766136-167766158 CAAATTTTCCACAGACCAGTGGG + Intergenic
984134221 4:175915593-175915615 CAGTTTTTCTACAGGGTGATTGG - Intronic
984410286 4:179389354-179389376 CAATTTTTTTTCAGTGTAGTAGG - Intergenic
986521835 5:8627703-8627725 CACCTTTTTCACAGGGTGGTAGG + Intergenic
986935739 5:12883764-12883786 CAATTTTTCCACAGAAGAGGAGG - Intergenic
987138393 5:14920830-14920852 CAATTTTTACACAGGGATGTGGG - Intergenic
987300639 5:16594849-16594871 CAATTTATCCAGAAGGTATTTGG + Intronic
988042989 5:25911876-25911898 CAATTTCTCCCCAGGGTGGATGG + Intergenic
988148803 5:27348358-27348380 CAATTTTTCACCAGGATAATTGG + Intergenic
988430773 5:31116165-31116187 CATTTTTTCCACAGGTTTGCTGG + Intergenic
988573268 5:32393192-32393214 AAATTATTCCACAGAATAGTGGG - Intronic
988950055 5:36246775-36246797 CAATTTTTCCACAGGCTAGGGGG - Intergenic
989512435 5:42303818-42303840 CAATTTTTCCACAGACTTGTTGG - Intergenic
990206014 5:53430317-53430339 CAGTTTTTACACAGGAAAGTGGG - Intergenic
990413907 5:55567759-55567781 TAATTTTTCCATAGGTTAATGGG + Intergenic
990435859 5:55791015-55791037 CATTTTTCCCCCAGCGTAGTGGG - Intronic
990612110 5:57468113-57468135 CAATTTTTCCACAGACTGGGGGG + Intergenic
990673170 5:58155323-58155345 CTATTTTTCCATAGGTTATTGGG - Intergenic
991142690 5:63263076-63263098 CAATTTTTAGACAAGGAAGTGGG - Intergenic
991539970 5:67716715-67716737 CAATTGTAGCACAGGGAAGTAGG + Intergenic
991992502 5:72354437-72354459 CCATTTTTCTTCAGGGTTGTTGG - Intronic
992317340 5:75570105-75570127 CAATTTTTCCACGGACTGGTGGG - Intronic
993160371 5:84282579-84282601 AAATTTTTGCACAGGGTACAAGG - Intronic
993206061 5:84879946-84879968 TAAGTTTTCCACAGGTTAATTGG - Intergenic
994569556 5:101498017-101498039 CAATAATTCCACAGTGTAGCAGG - Intergenic
995134444 5:108665834-108665856 AAATTTTTCCATAGGTTATTGGG + Intergenic
997546757 5:134714558-134714580 TAATTTTTCCACAGACTGGTGGG - Intronic
997831141 5:137151104-137151126 CTATTTTACCAGATGGTAGTAGG + Intronic
997929049 5:138057361-138057383 CAATTTTACCACAGGCTAATTGG + Intergenic
999067472 5:148705119-148705141 GAATTTTTCCACATGCTTGTTGG - Intergenic
999719783 5:154391106-154391128 CAGTCTTTCCACAGGGTCCTGGG - Intronic
1001192419 5:169643387-169643409 CAATTTTTCCACAGACTGATGGG + Intronic
1002550958 5:179991674-179991696 CAATTTTTCCACAGACTGGCGGG + Intronic
1002563009 5:180095144-180095166 CCATTTTTCCATTGGATAGTTGG + Intergenic
1003231967 6:4262399-4262421 CAATTTTTCCACAGGGGGCGGGG - Intergenic
1004034748 6:11912649-11912671 CAATTTTTCCACAGACCAGAAGG - Intergenic
1004835401 6:19526012-19526034 TAATTTTTCCATAGGTTATTGGG + Intergenic
1005100018 6:22161357-22161379 CAATTTTTCCACAGAACAGAAGG - Intergenic
1005527602 6:26666474-26666496 CAATTATTCCACAGACTGGTGGG + Intergenic
1005778684 6:29165574-29165596 AAATCTTCCCAAAGGGTAGTGGG + Intergenic
1008409250 6:51154157-51154179 TAATTTTTCCACATGTTATTGGG + Intergenic
1008459923 6:51756885-51756907 CAATTTTTCCACAGGGGAGGTGG + Intronic
1010805718 6:80233935-80233957 CAATTTTTCCACAGACTGGAGGG + Intronic
1012133637 6:95527549-95527571 CAATTTTCCTACAGGTAAGTTGG - Intergenic
1012294193 6:97499559-97499581 CAATTTTTTTTCTGGGTAGTAGG + Intergenic
1012482736 6:99685795-99685817 CAATTTATCCACTAGGTAGTTGG + Intergenic
1014369630 6:120588201-120588223 CAATTTTTCTACACAGTATTTGG - Intergenic
1015662752 6:135594378-135594400 TAATTTTTCCATAGGTTATTGGG + Intergenic
1015818975 6:137239993-137240015 TAATTTTTCCACAGGATTTTGGG + Intergenic
1016650756 6:146456612-146456634 CTTTTTTTCCATAGCGTAGTAGG - Intergenic
1017375361 6:153761865-153761887 CAATTTTTCCACAAACCAGTTGG + Intergenic
1017566570 6:155693387-155693409 GAAATATTCCACAGGATAGTTGG - Intergenic
1019010399 6:168839933-168839955 CAGTGTTTCCACAAGGTGGTAGG + Intergenic
1020250758 7:6466525-6466547 CAATTTTTCCACAGACCAGCAGG + Intronic
1021652585 7:22846329-22846351 CAATTTTTCCACAGACCCGTGGG + Intergenic
1023729109 7:43173495-43173517 CAATTTTTCCACAGAGTCCAGGG + Intronic
1024493676 7:50017018-50017040 CAATTTTTCCACAGACTGGGAGG + Intronic
1024614000 7:51092225-51092247 CAATTTTTCCACGGACCAGTGGG - Intronic
1024728711 7:52230824-52230846 CAATTTTTCCACAGACTGGTGGG + Intergenic
1028334884 7:89639619-89639641 CCAATCTTCCACAGGGTAGCTGG + Intergenic
1028336163 7:89658725-89658747 AAGTTTTCCCAGAGGGTAGTTGG + Intergenic
1028649666 7:93137616-93137638 CAATTTTTCCACAGGGTAGTGGG - Intronic
1029242560 7:99174451-99174473 CAAATTTTCCACAGGCTGGGGGG - Intronic
1030477970 7:110061711-110061733 CAATTTTTACATTGGGTTGTTGG - Intergenic
1031169687 7:118277041-118277063 CAATTTTTCCACAGAGGAGGTGG - Intergenic
1032795577 7:135273572-135273594 CAATTTTTCCACAGACTGGTTGG + Intergenic
1034918691 7:155061259-155061281 TTATTTTTCCACAGGTTATTGGG + Intergenic
1036289934 8:7478322-7478344 CAATTTATCCACATGATACTGGG - Intergenic
1036331543 8:7833205-7833227 CAATTTATCCACATGATACTGGG + Intergenic
1036431723 8:8698210-8698232 TAATTTTTCCATGGGGTTGTGGG - Intergenic
1036692588 8:10953191-10953213 TAATTTTTCCACAGACTAGGAGG - Intronic
1037266939 8:17073626-17073648 CAATTTTTCCACAGACCAGGAGG - Intronic
1037601543 8:20400394-20400416 CTTCTTTTCCACAGGGAAGTGGG + Intergenic
1037797432 8:22008268-22008290 CATTTTTTCCAGTGGGGAGTTGG - Intergenic
1037921558 8:22809914-22809936 AAATTTTCCCACTGGGTAGAAGG - Intronic
1038724507 8:30068580-30068602 CAATTTTTCCACGGACTAGGGGG - Intronic
1038866939 8:31449315-31449337 CAATTTTTCCACACACTGGTGGG + Intergenic
1039037362 8:33374209-33374231 CAATTTTTCCACAGACCGGTAGG - Intronic
1039577392 8:38634315-38634337 CTGCTTTTCCACTGGGTAGTTGG - Intergenic
1039728185 8:40244662-40244684 TAATTTTTCCATAGGTTATTCGG - Intergenic
1039730620 8:40272419-40272441 AATTTTTTCCACAGGGTGGGTGG - Intergenic
1040843952 8:51815537-51815559 TAATTTTTCCATAGGTTATTGGG - Intergenic
1041928296 8:63260515-63260537 CAATTTTTCCGCAGGGGATTGGG - Intergenic
1042707930 8:71681219-71681241 CAATTTTTCAACAGAGAGGTTGG - Intergenic
1044635869 8:94323369-94323391 CAATTTATTCACATGGTATTGGG + Intergenic
1046695331 8:117333379-117333401 TAATTTGTCCTCAGGGAAGTGGG - Intergenic
1048901734 8:139044462-139044484 CCATTTTTCCACAGGGTACCTGG - Intergenic
1050486884 9:6143720-6143742 CAATTTTTCCACAGACCGGTTGG + Intergenic
1052564700 9:30134451-30134473 CAATTTTTCCACAGGATGTTGGG + Intergenic
1052868505 9:33481385-33481407 CAATTTTTTTACAGGGTTGGGGG - Intergenic
1053182853 9:35988924-35988946 TAATTTTTCCATAGGTTATTGGG + Intergenic
1054897904 9:70334764-70334786 CCATTTTTTCACTGGGTTGTTGG - Intronic
1055053867 9:72005825-72005847 CCATTTTTCTACAGGTTTGTTGG + Intergenic
1055354959 9:75428297-75428319 CAATTTTTCCACAGACTGGGAGG - Intergenic
1059051620 9:110932828-110932850 CAATTTTTCCACAGATGGGTTGG - Intronic
1061976615 9:134071200-134071222 CAATTTTTCCACGGATGAGTGGG + Intergenic
1062133291 9:134911958-134911980 CAATCATGCCACAGGGCAGTGGG + Intronic
1186441621 X:9591826-9591848 GAATTTTTCCCCTGGGCAGTAGG + Intronic
1186498149 X:10028895-10028917 CAATTTGACCACAGGCTAATTGG - Intronic
1187051413 X:15699988-15700010 AAATTTTTTCACATGGTATTGGG - Intronic
1187654714 X:21458519-21458541 CAACTTTTCCATAGGGGAGAGGG - Intronic
1188545988 X:31307909-31307931 CAATTTTTCCACAGACTGGGAGG + Intronic
1189426787 X:40908965-40908987 CAAATTTTACAGAGGGTAATAGG - Intergenic
1189553756 X:42120163-42120185 CAATTTTTCCACAGGGCAAAAGG + Intergenic
1191870395 X:65740526-65740548 CAATTTCTCCCCAGGGTGGATGG + Exonic
1192559036 X:72113350-72113372 CATTTGGTCCACAGGGGAGTCGG - Intergenic
1194129723 X:90066512-90066534 CAAATTTCCCACACGGAAGTTGG + Intergenic
1194529466 X:95026953-95026975 CATTTTTTCCACAGGGTATGGGG + Intergenic
1195463302 X:105152132-105152154 CCATTTTTCCATAGGTTATTGGG - Intronic
1196394640 X:115246242-115246264 CAATTTTTCCACAGACCAGTTGG + Intergenic
1198188812 X:134283267-134283289 CAATTTTTCCACAGACTGGTGGG - Intergenic
1199150070 X:144421480-144421502 TAATTTTTCCATAGGTTATTGGG + Intergenic
1199622062 X:149711005-149711027 CGAGTTTTCCACAGTGAAGTAGG - Intronic
1201534394 Y:15030174-15030196 CGATTTTTCCACAGTCTAGGGGG + Intergenic