ID: 1028654595

View in Genome Browser
Species Human (GRCh38)
Location 7:93189823-93189845
Sequence CAGAGCTGGCACATTCAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028654589_1028654595 15 Left 1028654589 7:93189785-93189807 CCAAATAAAAGAAAGCAGAGAAG 0: 1
1: 1
2: 6
3: 109
4: 1127
Right 1028654595 7:93189823-93189845 CAGAGCTGGCACATTCAAGTTGG 0: 1
1: 0
2: 1
3: 10
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028654595 Original CRISPR CAGAGCTGGCACATTCAAGT TGG Intronic
900410367 1:2509926-2509948 CAGAGCTGCCAGATACAAGGTGG + Exonic
903587539 1:24427573-24427595 CAAAGGTGGCACAATCAATTAGG - Intronic
907599371 1:55751101-55751123 CAGAGCTGGGTCACTAAAGTTGG + Intergenic
908671312 1:66550827-66550849 GAGATCAGGCACATTCAAGGTGG + Intronic
1064567906 10:16661696-16661718 CAAAGCTAGCACATTCAAAGGGG - Intronic
1065246153 10:23760111-23760133 CATAGTTGGCACATGCAGGTTGG + Intronic
1065541239 10:26770065-26770087 CAAAGCTGGCAGATTCATTTGGG + Intronic
1065696971 10:28388786-28388808 AAGAGATGGCACATTCAAACTGG - Intergenic
1067068343 10:43115946-43115968 CAGAGCTGGCACATCAAGGGAGG + Intronic
1069089759 10:64185665-64185687 CAGAGCTGCCACTACCAAGTTGG - Intergenic
1073021298 10:100446529-100446551 CAGAGCTGGCAAATTGATGTTGG + Intergenic
1074283780 10:112079125-112079147 CAGAGCTGGCAAATGAAACTTGG - Intergenic
1074515210 10:114161008-114161030 CAGAGCTGGCAAATGCCAATGGG + Intronic
1075676870 10:124301927-124301949 CAGTGCTGGCAGATTCCAGGGGG + Intergenic
1078626246 11:12961575-12961597 CAGAGCAGGCAGATTCTGGTGGG - Intergenic
1079314264 11:19394587-19394609 CAGACATGGCACATTCAAACAGG + Intronic
1080174070 11:29340867-29340889 CAGTCCTGCCACATTCAAGTAGG - Intergenic
1080634834 11:34114635-34114657 CAGAGGAAGCACATTCCAGTGGG - Intronic
1082067945 11:47915926-47915948 AACAGATGGCACATTCAAATTGG - Intergenic
1082805910 11:57450196-57450218 AAGATCTGGCACATTCAGGGTGG - Intergenic
1083996467 11:66275539-66275561 CAGAGCTGGCAGGCCCAAGTTGG + Intronic
1084486594 11:69451837-69451859 CTGAGCTGCCACAGTCAAGAAGG - Intergenic
1088177814 11:107073919-107073941 AACAGCTGGCACACTCAACTTGG + Intergenic
1088339130 11:108743171-108743193 CAGATCTGCCACAATCAAGTAGG + Intronic
1088436146 11:109815269-109815291 CAGAACGTGCACATTCAAATTGG - Intergenic
1088945506 11:114508239-114508261 CAGAGCTGACACAAACAAATGGG + Intergenic
1091314479 11:134603162-134603184 CAGAGCTGATACATTTGAGTAGG + Intergenic
1093273913 12:17100260-17100282 CAGCACTGCCACAATCAAGTCGG + Intergenic
1097137474 12:56870740-56870762 GAGATCTGTCACATTCAAGGTGG - Intergenic
1098568219 12:71958928-71958950 CTCAGCAGGCACATTCAATTTGG + Intronic
1098842683 12:75495333-75495355 CAGAGCTGTCACAATTAAATGGG + Exonic
1101101328 12:101396482-101396504 CAGAGATGGCAAATTCACTTGGG - Exonic
1101774197 12:107778860-107778882 CAGGGCTGGATCATTCTAGTGGG - Intergenic
1101850390 12:108397323-108397345 CAGAGCTGTGACATTTAAATGGG + Intergenic
1103923704 12:124412537-124412559 CAGAGCTGCCTCATCCAAGTTGG + Intronic
1104448549 12:128852414-128852436 CAGATGTGGGACATTCTAGTGGG - Intergenic
1107926218 13:45264793-45264815 CAGAGGGCGCACATTCTAGTTGG - Intronic
1111781416 13:92730768-92730790 CAAAACTGGCAAATGCAAGTAGG + Intronic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112400934 13:99077770-99077792 CAGACCTGCCACATTCAAGATGG + Intronic
1113566810 13:111324270-111324292 CTCAGCTGGGACATTCTAGTGGG + Intronic
1115452661 14:33566033-33566055 CAGAGCTTCCACATTCAAAAGGG - Intronic
1117508974 14:56429620-56429642 CAGCTCTGGGACATCCAAGTGGG + Intergenic
1119531176 14:75362377-75362399 CAGAGGTGGCACTATCCAGTGGG + Intergenic
1120079827 14:80203150-80203172 CAGGGCTGGCAAAGTCAAGAAGG + Exonic
1121961227 14:98262097-98262119 CATAGCAGGCACATGCATGTTGG + Intergenic
1123819724 15:24016114-24016136 TAGACCTGGCACGTTCAACTTGG + Intergenic
1125562238 15:40643912-40643934 CTGAGCTGGTTCATTCAAGCTGG + Intronic
1127113183 15:55696792-55696814 CAGAGTTGTCAGATTCAAGCAGG - Intronic
1127140057 15:55966108-55966130 CAGAGCAGGCAGATTCTGGTGGG - Intronic
1131520029 15:93107500-93107522 CAGTGCTGCCAGATTCAGGTGGG + Intergenic
1134872407 16:17663832-17663854 CAGAGCTAGCAGATTGAGGTGGG + Intergenic
1138512440 16:57516380-57516402 CAGAGCTGGCACATGCCAACCGG - Exonic
1139160864 16:64507261-64507283 TACAGGTGGCACATGCAAGTGGG + Intergenic
1139176504 16:64695775-64695797 TAGGGCTGGAACATTCAAGAAGG - Intergenic
1140975781 16:80058661-80058683 CAGAGCTGGTAGATTGCAGTGGG + Intergenic
1141314007 16:82943019-82943041 CAGAGCTGTCATATTAAAATGGG - Intronic
1143996826 17:11013674-11013696 CACAGCTGCCACATTAAAGAAGG + Intergenic
1146638093 17:34520776-34520798 CAGGGCTGGCACAGTCTGGTAGG + Intergenic
1148375185 17:47137743-47137765 CACTGCTGGCACTTTTAAGTAGG + Intronic
1151188408 17:72380229-72380251 CAGACCTTGCACATACAAATAGG - Intergenic
1151756206 17:76076583-76076605 CTGAGCGGGCACATTCATGCTGG - Intronic
1152531442 17:80921762-80921784 CACAGCTGGCACAGCCTAGTGGG - Intronic
1153081540 18:1232000-1232022 CAGAGATGACACAATCAAATGGG - Intergenic
1156874099 18:41985118-41985140 TAGAGCTGGAACATCCAAGCTGG - Intronic
1159457877 18:68685287-68685309 CAGAGCAGGTACATACATGTAGG + Intronic
1159592506 18:70350635-70350657 TACAGCTGTCACATTCAAATAGG - Intronic
1161610634 19:5240408-5240430 CAGAGCTGGCATCTTTTAGTGGG - Intronic
1162843379 19:13372546-13372568 CAGATCTGCCACTTTCCAGTTGG + Intronic
1165003823 19:32788061-32788083 AAGAGCAGGCACTTTCAAGATGG - Intronic
925142784 2:1561411-1561433 CAGTGCCGGCACCTACAAGTGGG + Intergenic
925883814 2:8376881-8376903 CAGTGCTGGCACCTACAAGCTGG + Intergenic
928230637 2:29495595-29495617 AAGAGATGGCACATTCAAATTGG - Intronic
932813767 2:74845298-74845320 CAGCCCTGGCACACTCAACTTGG + Intronic
935031901 2:99330644-99330666 TAGAGCTGGCACACTTAGGTAGG - Intronic
938082517 2:128377765-128377787 CACAGCTGGCACACCCCAGTGGG - Intergenic
938574342 2:132589964-132589986 CAGAACTAGCACATTCATGGGGG - Intronic
941232349 2:162926479-162926501 CAGAGCTCGCACATACAGCTTGG + Intergenic
944200306 2:197099811-197099833 CGGAGCTGACACAGCCAAGTAGG - Exonic
946647521 2:221853993-221854015 CAGAGCAGGCAAAATCAGGTTGG - Intergenic
946794895 2:223339986-223340008 CACAGATGGCATATTCAAATGGG + Intergenic
948133378 2:235618275-235618297 AAGAGCTGGAAAATTCCAGTAGG + Intronic
1171288522 20:23965713-23965735 GAGAGCTGGCACGTTCAGGGTGG + Intergenic
1173071564 20:39773351-39773373 CAGGGCTGGCCAATTTAAGTTGG + Intergenic
1174290575 20:49505713-49505735 CAGAGCTGGCAGCCTCCAGTGGG - Exonic
1177129256 21:17236568-17236590 CAGAGATGGCACAATCCAATTGG - Intergenic
1177663028 21:24112622-24112644 CAGAGCTAGCACACAAAAGTTGG - Intergenic
1179960921 21:44766635-44766657 CAGGGCTGGGACATTCAACGGGG + Intergenic
1183028068 22:35081288-35081310 CACACCTTGCTCATTCAAGTTGG - Intronic
1183559801 22:38563397-38563419 CAGACTTGGCTCACTCAAGTAGG - Intronic
950747954 3:15105678-15105700 CAGAGCTGGCACAGCCAAGTGGG + Intergenic
951597572 3:24334805-24334827 CAGGTCTGGCACATTCAGGATGG - Intronic
952889646 3:38031410-38031432 CAGAGCTGGCACATGCAACCAGG + Intergenic
955724581 3:61919546-61919568 CACAGCTGTCACAATCCAGTAGG + Intronic
955878736 3:63521758-63521780 AACACTTGGCACATTCAAGTGGG + Intronic
957775781 3:84756312-84756334 CAGAGCTGTAACATTCTATTTGG - Intergenic
960716447 3:120579814-120579836 CAGAGATGTCACTTCCAAGTTGG - Intergenic
961019260 3:123490577-123490599 AAGAGCTGGCAGACTCAGGTGGG + Intergenic
961023664 3:123532487-123532509 CAGAGCTGGCATCACCAAGTTGG + Intronic
962312227 3:134334699-134334721 CAGAGCTGGCACATTGCAGCAGG + Intergenic
965598446 3:170431382-170431404 TTGAGATGGCACATTAAAGTTGG - Intronic
965725849 3:171714920-171714942 CAGAGATGACACACTCATGTGGG + Intronic
966840390 3:184082966-184082988 CAGAGCTGGCAGGTTCAAAAAGG - Intergenic
967542046 3:190679481-190679503 CATGGCTGGCACATTTAAATGGG + Intergenic
969676925 4:8619464-8619486 AAGAGCTGGCACCTCCCAGTGGG - Exonic
969920604 4:10536067-10536089 CAGAGCTGGCAGAGACAAATGGG + Intronic
969961008 4:10944837-10944859 CAGATGGGGCACATTAAAGTGGG + Intergenic
971287129 4:25301495-25301517 CACAGATGACACATTCAAGTGGG - Intergenic
974735154 4:65921048-65921070 CAGAGTTGGCTCCTTCCAGTGGG + Intergenic
975424615 4:74211533-74211555 CTTAACTGGCACAATCAAGTTGG - Intronic
981571195 4:146152316-146152338 CAGATCTGGAATATTGAAGTGGG - Intergenic
982732094 4:158966958-158966980 CGATGCTGCCACATTCAAGTGGG - Intronic
986244903 5:5998377-5998399 CAGAGCTGGGAGAGTCAAGGAGG - Intergenic
998649661 5:144103905-144103927 CAGAGGTGGCAAATTGAATTGGG - Intergenic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
999605891 5:153315436-153315458 CAGAGTTGGCTCCTTCCAGTGGG + Intergenic
1001208165 5:169783806-169783828 AAGAACTGGCACATTTAAGCAGG - Intronic
1002066546 5:176654770-176654792 CAGGGCTGGGACAGCCAAGTGGG - Intronic
1004210559 6:13637855-13637877 TAGTTCTGGTACATTCAAGTTGG + Exonic
1005929132 6:30468001-30468023 TCCATCTGGCACATTCAAGTTGG + Intergenic
1006562888 6:34928798-34928820 CAGAGCTGCCATTTTCAAGGTGG + Intronic
1006716838 6:36125761-36125783 CAGAGCTGACACAGTCCATTGGG + Intergenic
1008581219 6:52909152-52909174 TAGAGCTGGCACTTCCAAATGGG - Intronic
1011404195 6:87000229-87000251 CATAACTGGCAAACTCAAGTTGG - Intronic
1013279162 6:108618860-108618882 CAGAGAAGCCACATTCAAGGAGG - Intronic
1015213553 6:130723754-130723776 CTGAGCTGGCGCACTCTAGTGGG + Intergenic
1016240763 6:141927165-141927187 CAGAGATGTCACTTCCAAGTTGG - Intergenic
1016587027 6:145700156-145700178 CAGAGATGGCACATTTTAATAGG - Intronic
1025146922 7:56513218-56513240 CAGAGCTGGGATATTTAAATCGG - Intergenic
1027239080 7:76315538-76315560 CAGAACTGGCACATTTTAGGAGG + Intergenic
1028654595 7:93189823-93189845 CAGAGCTGGCACATTCAAGTTGG + Intronic
1032062967 7:128739846-128739868 CGGAGCTGGCAGATACAAGCAGG - Intronic
1032443608 7:131961344-131961366 CAGAGGAGGCTCATTTAAGTTGG + Intergenic
1036619828 8:10417292-10417314 CACTGCTGGCACATGCAAGGAGG - Intronic
1039276604 8:35939334-35939356 CAGAGTTGGCTCCTTCCAGTGGG - Intergenic
1039894536 8:41707145-41707167 CAGTGCTGGCACGGTCAAGAGGG + Intronic
1045573634 8:103395516-103395538 TAGAGATGGCACATTCAGGTCGG + Intergenic
1047595662 8:126375250-126375272 CTGAGCTGGCATTTTCCAGTAGG + Intergenic
1052730222 9:32276631-32276653 CAGAGCTGCCACAACCATGTGGG - Intergenic
1056570194 9:87808097-87808119 CAGAGGGGGCAAATGCAAGTGGG + Intergenic
1059326581 9:113507473-113507495 CAGAGCTGTCACATACCAGGTGG - Exonic
1062236711 9:135513744-135513766 CAGGGCTGGCTCATTCCAATTGG + Intergenic
1062437096 9:136551180-136551202 CAGGGCTGGCACCTCCAGGTAGG + Intergenic
1188035245 X:25310426-25310448 CAGAGATGACACAAACAAGTGGG - Intergenic
1189919978 X:45893959-45893981 CAGAGGTGGCACATAGCAGTGGG + Intergenic
1198311558 X:135429454-135429476 CAGAACTGGCTCATTAAGGTAGG + Intergenic
1199501661 X:148513796-148513818 CTGACCTGGCACATTCCTGTTGG + Intronic