ID: 1028654751

View in Genome Browser
Species Human (GRCh38)
Location 7:93191954-93191976
Sequence TACCCAGATGTGGATTCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028654747_1028654751 -6 Left 1028654747 7:93191937-93191959 CCTGAACATTCCTTTCATACCCA 0: 1
1: 0
2: 0
3: 19
4: 225
Right 1028654751 7:93191954-93191976 TACCCAGATGTGGATTCCTTGGG 0: 1
1: 0
2: 1
3: 15
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028654751 Original CRISPR TACCCAGATGTGGATTCCTT GGG Intronic
900261633 1:1733436-1733458 CACCCAGAGCTGGATTTCTTTGG - Intronic
900863193 1:5247292-5247314 TACCTAGGAGTGGATTCGTTGGG + Intergenic
901820774 1:11827987-11828009 TACCCGGATGTAGATTCCGGAGG + Intronic
902660142 1:17895281-17895303 TGCCTAGATGTAGATTCCATTGG + Intergenic
904302401 1:29562786-29562808 TGCCCATATTTGGTTTCCTTGGG - Intergenic
911496289 1:98635689-98635711 TACTCAGATGTGTAGCCCTTTGG - Intergenic
911869111 1:103070041-103070063 TACCTAGATGTGGAATGCATGGG - Intronic
912307791 1:108588222-108588244 TACCCAGATGTGGAATTGCTGGG + Intronic
917065541 1:171089078-171089100 TCCAAAGATGTGGATTCTTTAGG - Intergenic
917083810 1:171285304-171285326 GAGCCAGATGTGGATCCGTTAGG - Exonic
917665889 1:177225094-177225116 TACCCAGCTGAGGACTTCTTGGG - Intronic
917813416 1:178683322-178683344 TACCCATATTTGTATTACTTGGG + Intergenic
918983087 1:191588755-191588777 TGCCCAGCTCTGCATTCCTTTGG - Intergenic
919010206 1:191950270-191950292 TACCCAGGTGTGGATTCTGTAGG - Intergenic
920626074 1:207601430-207601452 TACCCAGAAGTGGAATTCCTGGG + Intronic
1065098910 10:22314296-22314318 TACCCAGATGTAGACTCTCTTGG - Intergenic
1067152833 10:43750783-43750805 TACCCAGAAGTGGAATTGTTGGG + Intergenic
1067353384 10:45498962-45498984 TACCCAGAAGTGGATTTCCTGGG + Intronic
1067540028 10:47144365-47144387 TAGCCCCATGTGGGTTCCTTAGG - Intergenic
1069408568 10:68128252-68128274 TACCCAGCTGTACATTCCTGGGG - Intronic
1069899525 10:71699427-71699449 TTCCCACATGTGGCTTCATTTGG + Intronic
1074036141 10:109740746-109740768 TAAACAGATGTGGTTACCTTGGG + Intergenic
1074106564 10:110393527-110393549 GACCCACATGTGGATTCCACAGG + Intergenic
1076056174 10:127374982-127375004 TGCCCAGATCTGGTTTCCTGTGG - Intronic
1078134110 11:8638125-8638147 AACCCAGAGTTGGATACCTTAGG - Intronic
1080573358 11:33577017-33577039 TTCCCATATGTGGATTCCCCAGG - Intronic
1081384072 11:42450006-42450028 TATTCAGATGTGGATATCTTTGG - Intergenic
1082682615 11:56195205-56195227 TACCCAGATTTTAAATCCTTTGG - Intergenic
1084915162 11:72423296-72423318 CACCGAGATGTGGATCCCTGAGG - Intronic
1085341429 11:75734006-75734028 TACCCAGGGGTGGAGTCCCTGGG + Intergenic
1089403863 11:118181388-118181410 AATGCAGATTTGGATTCCTTGGG - Intergenic
1092830741 12:12442077-12442099 TCCCCAGGTGTGGTTTCCCTGGG + Intronic
1093226703 12:16493012-16493034 TACTCACATGTGCATTCCTCGGG - Intronic
1093407820 12:18826648-18826670 GATCCAGATGTCAATTCCTTTGG + Intergenic
1093879473 12:24387515-24387537 GACTCAGATGTGCATTCCCTGGG + Intergenic
1095421157 12:42025219-42025241 TACCCAGAGGCAGCTTCCTTTGG + Intergenic
1097378400 12:58865249-58865271 GAGCCAGCTGTGTATTCCTTAGG - Intergenic
1098086531 12:66850312-66850334 AATCCAGATGTGGGTTCCTGAGG + Intergenic
1098845812 12:75534421-75534443 TACCCAGATGAGGATCACTTTGG - Intergenic
1106132045 13:26948760-26948782 TACACAGCCCTGGATTCCTTGGG - Intergenic
1107217631 13:37940369-37940391 TAACCAGCTGTGGTTTCCTTAGG + Intergenic
1107745596 13:43504326-43504348 GACCCAGACTTTGATTCCTTTGG - Intronic
1117284356 14:54272440-54272462 TCCACAGATGTGGATTCCGAGGG + Intergenic
1118579884 14:67285340-67285362 AATCCAGATGGAGATTCCTTAGG + Intronic
1119026720 14:71158381-71158403 TCCCCACATGTGGAAACCTTAGG - Intergenic
1121331738 14:93053924-93053946 TACCCAGTTGTGGAGTCATCTGG + Intronic
1121456459 14:94041796-94041818 GACCCGGCTGTGGGTTCCTTGGG + Intronic
1124182366 15:27488592-27488614 TACCAACAGGTGGATTCATTGGG - Intronic
1124433709 15:29630444-29630466 TATCTTGATGTGGATTCTTTTGG + Intergenic
1124681223 15:31732863-31732885 TTCCTAGTTGTGCATTCCTTTGG + Intronic
1125142753 15:36428806-36428828 CACCCAGATGTGAATTCAATAGG + Intergenic
1128255744 15:66195413-66195435 AACCCCGATGTGACTTCCTTAGG - Intronic
1129946496 15:79543211-79543233 TCCCCAGATGTGGATTGTTCTGG - Intergenic
1135942332 16:26833014-26833036 TACCCAGATGGAGTTTTCTTAGG - Intergenic
1136094204 16:27942888-27942910 TACCCAGATGTGGAATTCCTGGG - Intronic
1137881453 16:52053059-52053081 TTCCCAGATGAGGATCCCATTGG - Intronic
1138245872 16:55466992-55467014 TAGCCAGAAGTGGGGTCCTTGGG - Intronic
1141055708 16:80811826-80811848 TATCTAAATGTGGATACCTTTGG - Intergenic
1142814155 17:2412293-2412315 TGCCCAGATGTGGGTTTATTTGG - Intronic
1142955743 17:3520372-3520394 TACCCTGAGGTGATTTCCTTTGG - Intronic
1143938462 17:10512382-10512404 AACCCAGATGGAGATTCATTTGG + Intronic
1144935012 17:18890629-18890651 TCCCCAGAACTGGATTGCTTTGG - Intronic
1145997999 17:29115476-29115498 TACCCAGATGGGGAGCCCTGGGG - Intronic
1149332524 17:55600940-55600962 TCCCCAGATGTAGAATTCTTTGG + Intergenic
1149585925 17:57786704-57786726 TGCCTAGATGGGGATGCCTTTGG + Intergenic
1151726372 17:75887222-75887244 ATCCCAGGTGTGGATCCCTTTGG + Intronic
1152037573 17:77882911-77882933 TATCTAGATGTGGAGTCCTTTGG + Intergenic
1152989285 18:348589-348611 TACCTAGAAGAGGATTCCATTGG + Intronic
1156444309 18:37223514-37223536 TTCCCAGATGTGTATTACTTGGG + Exonic
1159729943 18:72013565-72013587 AACACAGATGTGGATTCAGTGGG + Intergenic
1160110971 18:76030238-76030260 AACCCAAATGTGGCTTCCATAGG + Intergenic
1160807182 19:997211-997233 TACCCAGAAGTGGACTCGCTGGG - Intronic
927143941 2:20148581-20148603 TACCCCGATGGGGTTTCTTTGGG - Intergenic
928008585 2:27585449-27585471 TAACCAGATTTGGAATCATTGGG + Intronic
932130437 2:69182374-69182396 TACCCAACCCTGGATTCCTTTGG - Intronic
933190425 2:79327995-79328017 TCCCAAGAAGTGGTTTCCTTAGG - Intronic
933210832 2:79567002-79567024 TACCCAAATGTGTATTTGTTGGG - Intronic
936101721 2:109587566-109587588 TCCCTAGATGTGAGTTCCTTTGG - Intronic
936602017 2:113906009-113906031 TACCCAGAAGTGGAATTGTTGGG + Intronic
936635972 2:114258583-114258605 TTCCCAGGGGTGGTTTCCTTTGG + Intergenic
936969060 2:118158078-118158100 TGTCCAGGTGTGGATTTCTTTGG - Intergenic
937452132 2:122010507-122010529 TCCACAGATGTGGCTTCCCTGGG - Intergenic
938323595 2:130382261-130382283 TGCCCAAAAGTGGACTCCTTGGG + Intergenic
939191288 2:138919448-138919470 CAGCCAGCTGTGGATTGCTTAGG + Intergenic
940394330 2:153170334-153170356 TAACAAGATGTGGCTTTCTTTGG - Intergenic
944681487 2:202081361-202081383 TACCCAGAAGTGGAATTGTTTGG + Intronic
944916702 2:204368337-204368359 GACCCAGATGAGGCTTCCTTCGG - Intergenic
1168986296 20:2051799-2051821 TACCCAGATTTGGATACTCTAGG - Intergenic
1169617179 20:7461386-7461408 TACCCAGATGTAGGTTCCAAAGG + Intergenic
1169953133 20:11070407-11070429 TTCCCAGAAGTGGATTTCTTGGG - Intergenic
1170397475 20:15942953-15942975 TACCCAGGCTTGTATTCCTTTGG + Intronic
1170700860 20:18702241-18702263 TACACAGTTGTGGATTACTCAGG - Intronic
1171775377 20:29362551-29362573 TACCCACCTGTGAATCCCTTAGG + Intergenic
1173218664 20:41112746-41112768 AACCCAAATGTAGATTACTTTGG - Intronic
1173413310 20:42834710-42834732 TTCCCAGATGTTAATTTCTTTGG + Intronic
1173422114 20:42910545-42910567 TAGCCAGCTGTCGATTACTTGGG - Intronic
1173910905 20:46670100-46670122 CACCCATATGTAGCTTCCTTTGG + Intronic
1175617334 20:60411861-60411883 TACCCAGGTGTGGACTCACTTGG + Intergenic
1177127366 21:17212204-17212226 TACCAAGATGTGGAGACTTTAGG + Intergenic
1179021335 21:37643630-37643652 CACCCAGATGTGGACACCTGAGG + Intronic
1182051957 22:27319456-27319478 TTCCTAGAAGTGGAATCCTTAGG + Intergenic
1184198694 22:42950032-42950054 TCCACAGATGTGGAACCCTTGGG - Intronic
949368273 3:3306727-3306749 TACCCAGTTGAGCATCCCTTTGG - Intergenic
951129933 3:19030100-19030122 TTCCCAGCTGTGGAGACCTTGGG + Intergenic
952580060 3:34823047-34823069 TACACAGTGGTGAATTCCTTGGG - Intergenic
952907054 3:38147074-38147096 TACCTTGGTGTGGATTTCTTGGG - Intergenic
953974827 3:47374522-47374544 TAAGTAGATGTGGATGCCTTGGG + Intergenic
956422945 3:69103581-69103603 AACCCTGATGTGGATTCATCTGG - Intronic
957252151 3:77786556-77786578 TATCCAAATGTTCATTCCTTTGG - Intergenic
959140516 3:102480936-102480958 TAGCCAGAAGAGGATTCGTTTGG + Intergenic
963933963 3:151033852-151033874 TACTCAGATGTGATTTCCTCTGG + Intergenic
966385797 3:179396394-179396416 CACTTAGATGTGGATGCCTTTGG + Intergenic
967847836 3:194058226-194058248 TCCCCAGAGGTGCATTCGTTAGG + Intergenic
970663061 4:18307810-18307832 TACCCAGATGTGGACTCCTCTGG - Intergenic
970714369 4:18904603-18904625 TACCCAGATGTGGCTACCATAGG + Intergenic
971511904 4:27436847-27436869 CACACAGATGTGGATGCCCTTGG + Intergenic
972057791 4:34826392-34826414 ATGCCAGAGGTGGATTCCTTTGG + Intergenic
975390224 4:73807529-73807551 TACCCAGAATAGTATTCCTTAGG - Intergenic
975525010 4:75339414-75339436 GAATCAGATGTGGATACCTTTGG + Intergenic
978368437 4:108006599-108006621 TACCCAGAGTTTGATTCATTGGG + Intronic
979849165 4:125555421-125555443 ATCACAGAAGTGGATTCCTTAGG - Intergenic
981364314 4:143884368-143884390 AATCCAGATATGCATTCCTTAGG + Intronic
981385428 4:144124859-144124881 AATCCAGATATGCATTCCTTAGG + Intronic
981670883 4:147285918-147285940 AACCCAGATGGGGATTCTGTTGG + Intergenic
984225223 4:177026838-177026860 TATCCAGGTATGGACTCCTTTGG - Intergenic
985620146 5:950282-950304 TACCAAGGTGTAGATTTCTTGGG + Intergenic
994093103 5:95825851-95825873 GACCCACCTGGGGATTCCTTAGG + Intergenic
998312187 5:141144590-141144612 TGCCTCGGTGTGGATTCCTTTGG - Intronic
998891308 5:146748906-146748928 TACCCAGAGGTGCAATTCTTGGG + Intronic
1001605211 5:172954840-172954862 TAACCAGATGTGGATTACAGTGG + Intergenic
1001851668 5:174972978-174973000 TGCCCAGATGTGAAATTCTTAGG - Intergenic
1003089188 6:3087189-3087211 TATCTTGGTGTGGATTCCTTTGG + Intronic
1005314485 6:24591234-24591256 TACCCAGAAGTGGAATTCCTGGG + Intronic
1005910833 6:30308048-30308070 TACCCAGACTTGCATTCCCTGGG - Intergenic
1007592347 6:43030003-43030025 TTCCCAGTTGTAGATGCCTTAGG - Intronic
1007980881 6:46156859-46156881 TACCTAGGTGTGGATTTATTTGG + Intergenic
1009623756 6:66108843-66108865 TACCTAGAAGTGGATACTTTTGG - Intergenic
1010178052 6:73052506-73052528 TAGCCTGATGGGGTTTCCTTGGG - Intronic
1011192642 6:84748752-84748774 TTCTCAGATGTGGAATCATTGGG - Intronic
1013680763 6:112522822-112522844 TACCCAGAGGTGGACTCATGAGG + Intergenic
1018523607 6:164681092-164681114 TGACAAGATGTGGATTACTTAGG - Intergenic
1022382589 7:29874332-29874354 TTTCCTGATGTGGAGTCCTTGGG + Intronic
1023764544 7:43498366-43498388 TAACCAGATGTTGATCCCTTGGG + Intronic
1028654751 7:93191954-93191976 TACCCAGATGTGGATTCCTTGGG + Intronic
1029119715 7:98259231-98259253 AACCAGGATGTGGATGCCTTTGG + Intronic
1030177118 7:106666064-106666086 TACCTTGATGTAGATTTCTTTGG - Intergenic
1030807099 7:113931985-113932007 TTCCAAGAGGTGGATTCCCTTGG + Intronic
1031026754 7:116687523-116687545 TGTACAGATGTGGATTCCTTGGG - Intronic
1031468913 7:122146039-122146061 TACCCAGATGCTTAATCCTTAGG - Intergenic
1034984994 7:155506269-155506291 TACACAGTTGTGCATTCTTTTGG - Intronic
1036707092 8:11054235-11054257 TGCCCAGATGTGGCTTGCTTTGG - Intronic
1037801060 8:22036300-22036322 TACGCATATGTGTTTTCCTTAGG - Intronic
1038124093 8:24651909-24651931 TAACCAGCTGAGGACTCCTTGGG + Intergenic
1039814172 8:41077887-41077909 TGCCCAGATGTGAGTCCCTTGGG - Intergenic
1040388235 8:46928653-46928675 TCCCCAGGTGTGGATGACTTTGG - Intergenic
1041527792 8:58827213-58827235 TACTCACATGTGGTTTCCCTGGG - Intronic
1041661718 8:60407462-60407484 TACACAGCAGTGGATTTCTTGGG + Intergenic
1045528084 8:102958587-102958609 TACCCAGATGCTGATTCGGTAGG - Intronic
1047544014 8:125797779-125797801 TAGCCAGATGTGCATTCACTTGG - Intergenic
1052706406 9:31998585-31998607 TTCTCAGATGTTGATTCTTTGGG - Intergenic
1057089004 9:92239506-92239528 TATGTAGATGTGGATTCTTTTGG + Intronic
1057286498 9:93759612-93759634 TACCCAGAAGTGGAATAGTTGGG - Intergenic
1186933712 X:14423716-14423738 TACCCAGATGTTGATTTCTATGG + Intergenic
1192248044 X:69389290-69389312 ATCCCAGATGTGGATTCCCCTGG + Intergenic
1192478300 X:71462831-71462853 TTCCTAGATGTGGATTTTTTGGG - Intronic
1192564936 X:72155711-72155733 TCCACAGATGTTGATTCCTAGGG - Intergenic
1198328948 X:135603694-135603716 TAACCATATGTTTATTCCTTTGG + Intergenic
1198659449 X:138951860-138951882 TACCTAGATGTGGATTTCCTGGG - Intronic
1199248067 X:145630432-145630454 CACCTTGATCTGGATTCCTTTGG - Intergenic
1199395755 X:147335952-147335974 TGCCTAGTTGTGGATTTCTTTGG - Intergenic
1200082903 X:153588097-153588119 AACGCAGATGTGGCTGCCTTGGG + Exonic
1202579850 Y:26368576-26368598 TACCCAGATTTGGACTGTTTAGG - Intergenic