ID: 1028657273

View in Genome Browser
Species Human (GRCh38)
Location 7:93222988-93223010
Sequence GAAGTCTGTATAATTGCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028657273 Original CRISPR GAAGTCTGTATAATTGCCTT GGG Intronic
900696461 1:4014436-4014458 CAAGTCTGGATAATTGTTTTCGG + Intergenic
902679944 1:18036251-18036273 GAAGTATGCAGATTTGCCTTGGG + Intergenic
906447331 1:45913725-45913747 GAAGCTTTTATAATTTCCTTTGG + Intronic
908395010 1:63717370-63717392 GAAATCTATATTATTGCTTTTGG + Intergenic
908905380 1:69002785-69002807 GCAATCTGTTTCATTGCCTTTGG + Intergenic
1065419275 10:25523499-25523521 AAAGTTTTTATAATTGCCTGTGG + Intronic
1067023710 10:42825365-42825387 TAAATCTGTATATTTGCTTTGGG + Intronic
1068624895 10:59232901-59232923 GAAATCCTTATAATGGCCTTGGG - Intronic
1070500328 10:77066655-77066677 GAAGTGAGTATAATTGTATTGGG + Intronic
1071716527 10:88102383-88102405 TAAGTCTGTAAAATTTCTTTTGG + Intergenic
1071869021 10:89771435-89771457 TAAGTCTTTGTAATTGCCTATGG - Intronic
1073926041 10:108517974-108517996 GAAGTATGTAAAATTTGCTTTGG - Intergenic
1078416339 11:11169254-11169276 GAAGTCTGTAGAATTTCCTGAGG - Intergenic
1083044212 11:59718190-59718212 TAAGTCTATATAATTGCCTCTGG + Intronic
1088415074 11:109579776-109579798 GAAGTCTATTTAATTATCTTTGG + Intergenic
1089811901 11:121138999-121139021 GAAGTCAGTATAGTTGCCCAGGG - Intronic
1090996920 11:131875017-131875039 TAAGTCTCTATTCTTGCCTTTGG - Intronic
1091351703 11:134903129-134903151 GAACTATGTTTAATTGCCTTGGG + Intergenic
1094874285 12:34623363-34623385 GAATTCTGTATAATTCCCAAGGG - Intergenic
1096637445 12:52969858-52969880 GAAGACTGTTTAAGTGACTTGGG - Intergenic
1096713470 12:53475718-53475740 GAAGCCTGTATAACTGACATGGG + Intronic
1098346401 12:69508861-69508883 GAAGTATGTATAAAAGCCTGTGG - Intronic
1099506370 12:83481455-83481477 GAAGTCTGCAAAATTGCCCTGGG + Intergenic
1099875559 12:88401631-88401653 GTATTCTTTATAATAGCCTTAGG - Intergenic
1100027927 12:90152189-90152211 AAAGTCTTTGTAATTGCCTATGG + Intergenic
1100614686 12:96221931-96221953 GAAGCCAGAATAATTGCCTTGGG - Intronic
1100948357 12:99815358-99815380 TAAGTTTGTAAAATTGCCTTTGG + Intronic
1103455999 12:121065930-121065952 GTAGTATGTATATTTTCCTTTGG + Intergenic
1105397759 13:20056214-20056236 GAAGTGTGTATCATTTCCATTGG + Intronic
1108293933 13:48993044-48993066 GAAGAATTTTTAATTGCCTTTGG - Intronic
1109495172 13:63160278-63160300 GAAATCAGTATCATTCCCTTTGG + Intergenic
1110178618 13:72588146-72588168 GATATCTGAATAATTACCTTAGG - Intergenic
1111116516 13:83785707-83785729 GGATTCTGAATAATTGTCTTTGG - Intergenic
1111479609 13:88807092-88807114 GTAGTCAGTATTATAGCCTTAGG + Intergenic
1111646866 13:91042145-91042167 GAAGTCTGAACAATTGACTCAGG + Intergenic
1113607352 13:111619749-111619771 AAAGTCTGTAAAATTTCCTTTGG + Intronic
1113956617 13:114102855-114102877 GTCGTCTGTATAATCGCCGTGGG + Intronic
1116433222 14:44870012-44870034 GAAGTTTTTATATTTGCATTTGG + Intergenic
1117301049 14:54428421-54428443 GCACTCTGTAGAATTGCCCTTGG - Intronic
1117318944 14:54602194-54602216 CAAGTCTGGATTATTTCCTTAGG + Intronic
1119031876 14:71199202-71199224 GAAGTCTGTAGAATGGACTTTGG - Intergenic
1119244076 14:73088557-73088579 AAAGTCTGATTACTTGCCTTAGG + Intronic
1119352478 14:73977409-73977431 GAAATCTATTTTATTGCCTTAGG - Intronic
1120222432 14:81749426-81749448 GAATTCTGTATAATTGTATTTGG + Intergenic
1122525793 14:102383186-102383208 GAAGTCAGAATAGTTACCTTGGG - Intronic
1123424857 15:20162397-20162419 TAAATCTGTATATTTGCTTTGGG + Intergenic
1123534081 15:21168928-21168950 TAAATCTGTATATTTGCTTTGGG + Intergenic
1126955825 15:53932537-53932559 TTAGTATGTCTAATTGCCTTGGG - Intergenic
1128282805 15:66410553-66410575 GCAGTCTGGATACCTGCCTTTGG - Intronic
1128387714 15:67162572-67162594 GAAGCCTTTATCATGGCCTTTGG + Intronic
1129138506 15:73575654-73575676 GAAGCCTGTACTATTGCATTGGG + Intronic
1136860002 16:33693338-33693360 TAAATCTGTATATTTGCTTTGGG - Intergenic
1139233181 16:65306985-65307007 GAAGTCTTCCTCATTGCCTTGGG - Intergenic
1139392819 16:66615898-66615920 TAAGTCAGTATAATTGCATTTGG - Exonic
1139426864 16:66886108-66886130 AAAGTCTATAGAATTGGCTTGGG + Exonic
1203121507 16_KI270728v1_random:1541504-1541526 TAAATCTGTATATTTGCTTTGGG - Intergenic
1143432165 17:6895217-6895239 GAAGTCTGTATATTGGTTTTGGG - Intronic
1146131630 17:30281987-30282009 GAAGCCTTTATGATTGACTTAGG - Intronic
1146388634 17:32400579-32400601 GAACTCTGTATTTTTGCCATAGG - Intergenic
1147125134 17:38362336-38362358 GAAGGCTGTAGAATCTCCTTTGG + Intronic
1150860345 17:68795003-68795025 AAAGTCTGTATAATCCCCTAAGG + Intergenic
1158403639 18:57142464-57142486 GAAGACTGTATATCTGCCCTGGG - Intergenic
1166635772 19:44450764-44450786 GAAGGCTGAATATTTACCTTGGG - Intergenic
1167824001 19:51955248-51955270 AAAGTCTGTATAGTTTCATTGGG - Intergenic
925529927 2:4848145-4848167 AAAGTCAGTAAAATTTCCTTGGG - Intergenic
925626811 2:5849688-5849710 CATGTGTGTATACTTGCCTTTGG + Intergenic
929849736 2:45574900-45574922 TATGTCTGTATTATTGCTTTTGG - Intronic
934458361 2:94194456-94194478 TAAATCTGTATATTTGCTTTGGG - Intergenic
934875840 2:97919301-97919323 AAAGACTGTATTATTTCCTTTGG + Intronic
937387512 2:121449500-121449522 AAAGTATTTAAAATTGCCTTAGG + Intronic
937563043 2:123248430-123248452 GATGTGTGTATATTTGCCTTGGG + Intergenic
938578324 2:132623794-132623816 GAAGCCCGCACAATTGCCTTGGG + Intronic
939409136 2:141801671-141801693 TAACTCTGTATAATTACATTAGG + Intronic
939633604 2:144554710-144554732 GAAATATGCATAATTGCCTATGG - Intergenic
945090161 2:206170832-206170854 GAAATCTGTATCTTTGTCTTTGG - Intergenic
947341867 2:229149133-229149155 AAAGTCTGTATAATTGGCATAGG + Intronic
1175799524 20:61793370-61793392 GAAATCTGTTTATGTGCCTTTGG - Intronic
1181357848 22:22311968-22311990 TAAATCTGTATATTTGCTTTGGG + Intergenic
949825614 3:8162041-8162063 GAAGTCTCTATTTTTGGCTTTGG - Intergenic
952440218 3:33319558-33319580 GAAAACTGTATCATTGCCTGGGG + Intronic
952770062 3:36992049-36992071 GATGTCTGAACAATTGGCTTAGG - Exonic
954153481 3:48671654-48671676 GAAGTCAGTGTCATTGACTTTGG + Intergenic
954940728 3:54369825-54369847 GAAGTCTGGCAAATTGCATTAGG + Intronic
956121215 3:65967755-65967777 GAAATCTGTTAACTTGCCTTGGG - Intronic
956208824 3:66782345-66782367 GAAGGATGTATGAATGCCTTCGG - Intergenic
960211605 3:114974383-114974405 GAAGTGTTAAGAATTGCCTTTGG - Intronic
963480222 3:145863439-145863461 GAGGTCTGTTTATTTGACTTAGG + Intergenic
970277531 4:14417897-14417919 GAAGTATCTCTAATTGCCATTGG - Intergenic
970560238 4:17275298-17275320 GGAATCTGTAAAATTTCCTTGGG - Intergenic
976542199 4:86291406-86291428 GAACATTGTATAGTTGCCTTAGG - Intronic
977647296 4:99427813-99427835 AAAGTCTGTTTAATTGGCTGTGG - Exonic
979801393 4:124913662-124913684 GAAGTCAGTGAATTTGCCTTTGG + Intergenic
980057005 4:128087360-128087382 TAAGTCTGTAAAATTTCCTTAGG - Intronic
980420183 4:132548556-132548578 GAAGCCTTTGTAATTGCCTGTGG - Intergenic
981441507 4:144788341-144788363 GAAGACTCTAAAATAGCCTTTGG - Intergenic
982652564 4:158104848-158104870 GAGCTCTGAATATTTGCCTTGGG + Intergenic
983437737 4:167736680-167736702 GAAGTCTGTGAAATTCCATTTGG + Intergenic
985878868 5:2622233-2622255 GAAGTATGGATAATTTGCTTTGG + Intergenic
992332166 5:75728622-75728644 GAAGTCTGGAAAAGTGTCTTTGG - Intergenic
994232683 5:97326157-97326179 AAAGTATCTTTAATTGCCTTAGG - Intergenic
995037717 5:107553694-107553716 GAATTCTGTAGAATTCCCATTGG - Intronic
997331104 5:133062484-133062506 GAAGTGGGTAAGATTGCCTTGGG + Intronic
998627390 5:143861222-143861244 GAGGTTTGTAAAATTCCCTTTGG + Intergenic
998769774 5:145529252-145529274 AAATTCAGTATGATTGCCTTTGG - Intronic
1001675653 5:173512659-173512681 GAAGTCTCTACAATGGCCTATGG + Intergenic
1003698168 6:8434061-8434083 CAGGTGTGTATAATTGCCTGAGG + Intronic
1004558431 6:16723078-16723100 GAAGTCTGTATAAATGTTTATGG - Intronic
1004750809 6:18560048-18560070 GAACTATGTTTAATTGACTTGGG + Intergenic
1005143980 6:22666441-22666463 GAAGTCGTTATATTTGTCTTAGG + Intergenic
1008224599 6:48899116-48899138 GAAGTATGTAGAATAGCGTTTGG - Intergenic
1011535419 6:88371178-88371200 AAAGTCTGTATGATTTCCTATGG + Intergenic
1012214023 6:96559596-96559618 GAAGTCTGTATGATAGAATTAGG - Intergenic
1012669852 6:102030555-102030577 GAAAACTGAATAATTTCCTTTGG - Intronic
1012864809 6:104606054-104606076 TAAATCTGTATCATTGCTTTGGG + Intergenic
1015512306 6:134050204-134050226 TATGTATGTATAATTGCTTTTGG + Intronic
1018635753 6:165857819-165857841 GAAGTCTGTATCACTGCAGTGGG + Intronic
1019103260 6:169649377-169649399 GACGTCTGCATAAATGCTTTCGG + Intronic
1022253107 7:28628467-28628489 GAAGCCTGTTTATTTTCCTTGGG - Intronic
1023529935 7:41142361-41142383 GTAGTCTGTAGAATATCCTTTGG + Intergenic
1023662490 7:42484444-42484466 GAAGTCTTTAGAATATCCTTAGG + Intergenic
1024221018 7:47286666-47286688 GAAATCTGGATTGTTGCCTTAGG - Intronic
1027969172 7:85056264-85056286 GAATTTTGTGTAATTGCCCTAGG + Intronic
1028269572 7:88772184-88772206 GAAGTGTGTATAATATCCCTGGG + Intronic
1028657273 7:93222988-93223010 GAAGTCTGTATAATTGCCTTGGG + Intronic
1028875725 7:95821386-95821408 GACGTCTGTGTGATTGCCTGGGG + Intronic
1029008157 7:97231523-97231545 GAAGTCTTTATAATTGTCAGTGG + Intergenic
1029308613 7:99640572-99640594 GAATTCAGTATAATTGCAATTGG - Intergenic
1030023283 7:105296949-105296971 GCAGTATGTATAGTTGCCTCTGG - Intronic
1032413671 7:131719623-131719645 GGTGTCTGTATATTTGCATTTGG + Intergenic
1033880586 7:145878434-145878456 GAAGTCAGTGTAATTTCATTCGG - Intergenic
1035136251 7:156705811-156705833 GAATTCTGTAGTATTGCCATTGG - Intronic
1040350160 8:46557911-46557933 GAAGTTGGTATATTTCCCTTGGG - Intergenic
1046413481 8:113879290-113879312 TGAGTCTGTAGAATTGCTTTGGG - Intergenic
1047822279 8:128534482-128534504 CAATTCTGTACAATTACCTTTGG + Intergenic
1050150608 9:2616171-2616193 GCAGTGTGTAAAATTGTCTTTGG + Intergenic
1050247302 9:3704013-3704035 AATGTCTGAATCATTGCCTTGGG - Intergenic
1053688869 9:40570272-40570294 TAAATCTGTATATTTGCTTTGGG - Intergenic
1054275169 9:63060802-63060824 TAAATCTGTATATTTGCTTTGGG + Intergenic
1054300109 9:63371189-63371211 TAAATCTGTATATTTGCTTTGGG - Intergenic
1054399662 9:64704138-64704160 TAAATCTGTATATTTGCTTTGGG - Intergenic
1054433245 9:65188399-65188421 TAAATCTGTATATTTGCTTTGGG - Intergenic
1054497138 9:65833270-65833292 TAAATCTGTATATTTGCTTTGGG + Intergenic
1056170151 9:83977892-83977914 CAAGTCTGTAGCAATGCCTTTGG - Intronic
1056236493 9:84599931-84599953 GAAGGCTTTAGAATTGTCTTTGG - Intergenic
1058328832 9:103733061-103733083 GAAGTCTGTCTGATTTCCTTAGG - Intergenic
1061842280 9:133366070-133366092 GAAGTCTGTGGAAATGCCTTTGG - Intronic
1186062174 X:5720827-5720849 GAAGGCTTTTTAATTGCTTTGGG - Intergenic
1188218009 X:27502443-27502465 AAAGCCTTTATAATTGCCTATGG + Intergenic
1188222317 X:27556088-27556110 GAAGTCTGCATGCTAGCCTTGGG + Intergenic
1190155614 X:47989804-47989826 GAAGTCTTTGTAATTGTCATTGG - Intronic
1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG + Intronic
1192647309 X:72916635-72916657 GCAGTCTGTAGAATTACCTCAGG - Intronic
1193364226 X:80611638-80611660 GAAGTGTTTATAATTGTCTCTGG - Intergenic
1194829253 X:98600396-98600418 GAAGTCTGGAGTAATGCCTTAGG + Intergenic
1197105887 X:122715211-122715233 GAAGTCTTTATAGTTGCCAATGG - Intergenic
1197985616 X:132263864-132263886 GAAGTCTGTATAAATGATGTTGG - Intergenic
1199715107 X:150502515-150502537 GAAGTTATTTTAATTGCCTTTGG + Intronic
1201931667 Y:19356387-19356409 TAAATCTGTAAAATTGCTTTAGG - Intergenic