ID: 1028661307

View in Genome Browser
Species Human (GRCh38)
Location 7:93279399-93279421
Sequence ATAGAGGAGCTGAATAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 326}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028661307 Original CRISPR ATAGAGGAGCTGAATAAAGA AGG Intronic
901389878 1:8937949-8937971 ATAGAGGAGCCAAATGAACAAGG - Intergenic
901748673 1:11392141-11392163 AGAGAGGAGCAGAATGAAGAAGG - Intergenic
903002523 1:20276413-20276435 ATAGACGTGCTCAATAAACATGG + Intergenic
903411898 1:23151509-23151531 ATAGAGGAGCAGAAAGAACATGG + Intronic
904004482 1:27356698-27356720 TCAGAGGAGCTGAGTAATGAAGG - Exonic
904040455 1:27581476-27581498 ATAGAGGTGTGTAATAAAGAAGG + Intronic
905553489 1:38862041-38862063 ATAGAGGATTTGAATATATAAGG - Intronic
906692250 1:47800242-47800264 AAAGTGGAGCATAATAAAGAGGG + Intronic
907230085 1:52989455-52989477 ACAGTGGAGCTGCAGAAAGAGGG - Intronic
907803234 1:57792392-57792414 ATAGAAAAGCTAAATAGAGAAGG - Intronic
907861022 1:58353126-58353148 ATAGAGGACACAAATAAAGAAGG - Intronic
908859512 1:68467553-68467575 GTAGAAGAGCTGAAACAAGATGG + Intergenic
908894219 1:68880765-68880787 TTCGAGGAGCTGAAAGAAGACGG - Intergenic
909854798 1:80515073-80515095 ATATGAGAGCTGAAAAAAGAAGG + Intergenic
910605964 1:89084833-89084855 GTTGAGGAGCTAAAGAAAGAGGG + Intergenic
913186068 1:116372375-116372397 CTAGAGGAGCTAAATCAAGGGGG - Intergenic
915166428 1:153950428-153950450 AGAGGGGACCTGAGTAAAGATGG + Intronic
916873885 1:168947713-168947735 ATTGAGGAGCTTAATATAGTAGG - Intergenic
917604853 1:176616668-176616690 ATAGAGGAGCTTAAGAAGTATGG - Intronic
917630979 1:176891113-176891135 ATAGAAGAGAGGAATTAAGAAGG + Intronic
918375377 1:183903794-183903816 ATAGAGGAGCTAAACAAAGCTGG + Intronic
919284863 1:195543934-195543956 ACAGAAGAGCTGAATATTGACGG + Intergenic
919340377 1:196299213-196299235 GTAGAAGAGCTAAATAGAGATGG - Intronic
921412443 1:214850177-214850199 ATAAGGGAGATGAAGAAAGAAGG + Intergenic
921627522 1:217394093-217394115 AAAGAGAGCCTGAATAAAGAGGG - Intergenic
922044152 1:221927607-221927629 ATAGAGGAGGTGGAGCAAGATGG + Intergenic
922853281 1:228752680-228752702 ATAATGAAGCTGATTAAAGAGGG + Intergenic
923326989 1:232888716-232888738 AGAAAGGAGGTGAATAAGGAAGG + Intergenic
924407223 1:243760653-243760675 ATAGGAGAGCTGAAGGAAGAAGG - Intronic
1064666640 10:17659444-17659466 AAAGAGGAAGAGAATAAAGATGG - Intronic
1065073582 10:22053182-22053204 ACCAAGGAACTGAATAAAGAAGG - Intergenic
1065758096 10:28953271-28953293 ATACAGGTGCTGAATACAGAGGG + Intergenic
1066710010 10:38223338-38223360 GTGGAGGAGATGAATATAGAGGG - Intergenic
1067322064 10:45230366-45230388 TTAGTGGAGCTGTATGAAGAGGG + Intergenic
1069207870 10:65715396-65715418 ATAAAGGAGCTGAATGTTGATGG - Intergenic
1069491159 10:68861744-68861766 TTAAAGGAGCTGCAGAAAGATGG - Intronic
1069864019 10:71489883-71489905 ATCGTGGTGCTGAATAGAGAGGG - Intronic
1070873991 10:79784153-79784175 AAAAAAGAGCTGAATAATGAGGG - Intergenic
1070888554 10:79925397-79925419 AGAGAGGAGCTCAAAAGAGATGG - Intergenic
1070906334 10:80076759-80076781 AAGGAGGAGAAGAATAAAGAGGG + Intergenic
1071640923 10:87306292-87306314 AAAAAAGAGCTGAATAATGAGGG - Intergenic
1071654313 10:87431644-87431666 AAAAAAGAGCTGAATAATGAGGG + Intergenic
1072063088 10:91836633-91836655 ATAAAGGAGATGACTAAAGATGG - Intronic
1072170607 10:92857165-92857187 ATAGAGGAGCAAAAAAAAAAAGG - Intronic
1073064773 10:100751460-100751482 GTAGAGGAGCTGGACAAGGAGGG + Intronic
1073745502 10:106463932-106463954 GTACGGGAGCTGAAAAAAGAAGG + Intergenic
1075964019 10:126594839-126594861 AGAGAGGAGGTGAAAAAAGAAGG + Intronic
1077731554 11:4736445-4736467 ATAGGAGAGAAGAATAAAGATGG + Intronic
1077922256 11:6650397-6650419 ATACAGGAGCTGAAGGAAGGGGG + Intronic
1078566496 11:12418646-12418668 AATGGGGAGCAGAATAAAGATGG - Intronic
1078671746 11:13371850-13371872 GTAGAGGAGGTGGATCAAGAAGG - Intronic
1080350839 11:31383879-31383901 ATAGAGGGACTGACTGAAGAAGG - Intronic
1080874150 11:36261368-36261390 ATAGAGGAGGGAAAGAAAGAAGG - Intergenic
1081745926 11:45472389-45472411 ATAGAGGAGGTGTAGAATGATGG + Intergenic
1082820525 11:57541683-57541705 ATAGAGGTGGTGTATAAAAATGG - Intergenic
1085892531 11:80597848-80597870 ATTGAAGAGCTCTATAAAGAAGG + Intergenic
1087555809 11:99719348-99719370 ATAGAGGATCTTATTTAAGAAGG + Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088041076 11:105382822-105382844 ACAGGGGAGCAGAATACAGAAGG - Intergenic
1088116749 11:106321145-106321167 ATTGTGGAGCTGACTGAAGATGG - Intergenic
1089389555 11:118091274-118091296 TTGGAGGAACTGAATAGAGATGG - Intronic
1090492442 11:127176627-127176649 AGAGAGGAGCTGTAGCAAGAAGG + Intergenic
1091158134 11:133392985-133393007 ATATAAGAGCTGAAACAAGAAGG - Intronic
1091792288 12:3278812-3278834 ATAAAGGAGCTGACTAATCAGGG - Intronic
1091906510 12:4193886-4193908 AAAGAGGACTTGAATATAGATGG - Intergenic
1093381809 12:18501956-18501978 ATAGAGGAACTGAAAAAATGAGG + Intronic
1093944640 12:25093668-25093690 ATAGATGAGCTGTGTAAAGGAGG + Intronic
1094188001 12:27665359-27665381 ATAGAGGAGGAGAGTGAAGAAGG + Intronic
1095341206 12:41090831-41090853 ATAAAGAAGGTGATTAAAGAGGG + Intergenic
1095537869 12:43273123-43273145 ATACAGGATCTGAATGAAAATGG - Intergenic
1095843560 12:46721235-46721257 AAAGAGAAGGAGAATAAAGATGG - Intergenic
1096081620 12:48837049-48837071 ATAGAGGAAAAGAAAAAAGAAGG + Intronic
1096774197 12:53954499-53954521 ATAAAGAAGCTAATTAAAGAGGG + Intergenic
1097477266 12:60073687-60073709 ACAGAGGAGCTTTATAAAAAAGG + Intergenic
1097503820 12:60439077-60439099 AAAGAGGAGCAGAATATAGGAGG + Intergenic
1098571843 12:71996710-71996732 ATAGAGGAGAAGAAGAAATAAGG + Intronic
1100858471 12:98779117-98779139 ATAAAGATGCTAAATAAAGAAGG - Intronic
1100910734 12:99359199-99359221 ATAGAGGAAATGCATAAAGTTGG - Intronic
1101266471 12:103093568-103093590 AAAGGGGATGTGAATAAAGAGGG + Intergenic
1104572965 12:129941625-129941647 ATAGAGGACCTGATTAAACCAGG + Intergenic
1106600810 13:31184983-31185005 ATAGTTAAGCTGAATAAATATGG - Intergenic
1106911808 13:34471124-34471146 ATATAGGAGCAGAAAAAAAAGGG + Intergenic
1107135894 13:36943702-36943724 ATAAAATAACTGAATAAAGAAGG + Intergenic
1107331546 13:39306768-39306790 ATAGAGGATCTGAAAAGACAGGG + Intergenic
1108968489 13:56342010-56342032 CTAGCGGAGCTGTAAAAAGAGGG - Intergenic
1109259098 13:60121879-60121901 AGAGAGAAGATGAATAAAGGAGG - Intronic
1109662232 13:65476881-65476903 AAAGAGCAGCTGATTGAAGAAGG - Intergenic
1109798499 13:67345604-67345626 ATAGAGGGATTGATTAAAGATGG - Intergenic
1110640819 13:77821761-77821783 AGAGAGGAGCTGAAAGAACAAGG - Intergenic
1111417485 13:87968056-87968078 ATAGACGGGCTCACTAAAGAGGG + Intergenic
1112382959 13:98910654-98910676 TTAGAGGAGCTGATTAGAAAAGG + Intronic
1113136931 13:107101176-107101198 ATGGAGGAGGGGAAGAAAGATGG - Intergenic
1113203284 13:107889853-107889875 ATCCAGGAACTGAATCAAGAGGG + Intergenic
1113418911 13:110154780-110154802 ATAGAGAAGCTGCTCAAAGATGG + Intronic
1114570865 14:23667330-23667352 GGAGAGGAGTTGAATGAAGAAGG - Intergenic
1115273108 14:31576702-31576724 ATAGAGGACCTGATAAAAGTGGG - Intronic
1115929324 14:38473036-38473058 ATAGAGGGGCTGACTAAACTTGG - Intergenic
1116079646 14:40156153-40156175 ATAGTGGAGCTGTGAAAAGAGGG - Intergenic
1118009877 14:61599888-61599910 ATAGGGGAACTGGATAAATAAGG - Intronic
1118426047 14:65663677-65663699 ATAGAGGACATAAAGAAAGAGGG - Intronic
1119150881 14:72358296-72358318 CTAGAGGAGCTGTAAGAAGAGGG + Intronic
1119217012 14:72876733-72876755 AGAGAGGAGCTGAGTTCAGAAGG - Intronic
1119370568 14:74137917-74137939 ATAAAGGAGCTTGATAAAGCAGG - Intronic
1119634443 14:76262642-76262664 AAAGAGGAGCAGCAGAAAGATGG + Intergenic
1119694119 14:76699000-76699022 GTAGAAGAGCTGAATAAGGAAGG + Intergenic
1120085626 14:80269405-80269427 AAAGAGGAGGTGAATGAAGGAGG + Intronic
1121610246 14:95273683-95273705 TTAGGGGAGGTGAAGAAAGAAGG + Intronic
1121699975 14:95945271-95945293 ATATAGGAGCTAAGGAAAGAGGG - Intergenic
1123696822 15:22884650-22884672 CTAGTGGAGCTGTAAAAAGAGGG - Intronic
1124087920 15:26568961-26568983 TCAGAGGAGCTGATTAGAGAGGG - Intronic
1124986864 15:34626875-34626897 ATACAGGAGGAGAGTAAAGATGG + Intergenic
1125152370 15:36547252-36547274 AGAGAGGAGCAGAAAAAAGAAGG + Intergenic
1126643024 15:50847028-50847050 ATTGGTGACCTGAATAAAGATGG - Intergenic
1126697342 15:51337733-51337755 ATAGAGGAGAAGAGGAAAGAGGG + Intronic
1127031554 15:54870032-54870054 TCAGAGGAGCTGAAAAAAGAGGG + Intergenic
1127313150 15:57770190-57770212 AGGGATGAGCTGAGTAAAGAAGG - Intronic
1129223250 15:74147525-74147547 AAAGAGAAGCTGAAGAGAGAGGG - Intergenic
1130285634 15:82552203-82552225 AAAGAAGAGCAGAATAAAGACGG + Intronic
1130294541 15:82635751-82635773 ATAGAAGAGAGGAATAAAGTAGG + Intronic
1131208106 15:90468876-90468898 ATAGAGGAGGTGACTTGAGATGG - Intronic
1131965252 15:97835252-97835274 ATAAAGGAGCTGTATACAAAAGG + Intergenic
1135175225 16:20221853-20221875 ATAGAGGAGGAGAAGAGAGAGGG - Intergenic
1135297940 16:21299788-21299810 ATAGAGGAGGTTAATACAAAAGG - Intronic
1135517121 16:23145432-23145454 ACAGAGGAGATGAGTAAAGGAGG - Intronic
1136842605 16:33551211-33551233 ACAGAGGAACTGAAAAAATATGG + Intergenic
1138025151 16:53516354-53516376 AAAAAGGAGCTGAAGAGAGATGG + Intergenic
1138034916 16:53594388-53594410 ATAGAAGTGCAGAATGAAGAGGG - Intergenic
1138833016 16:60398704-60398726 ATGGAGAGGCTGACTAAAGAAGG - Intergenic
1140634790 16:76899173-76899195 ATAGGGTAGCAGAATAGAGAAGG + Intergenic
1141404362 16:83778852-83778874 ACTGAGGAGTTGACTAAAGAGGG - Intronic
1142289365 16:89185704-89185726 CTAGAGGAGCTGACTCAAGGGGG - Intronic
1203002153 16_KI270728v1_random:172596-172618 ATAGAGGAACTGATAAAATATGG - Intergenic
1203133757 16_KI270728v1_random:1709003-1709025 ATAGAGGAACTGATAAAATATGG - Intergenic
1203152770 16_KI270728v1_random:1851508-1851530 ACAGAGGAACTGAAAAAATATGG + Intergenic
1142673806 17:1500941-1500963 AAAAAGCAGTTGAATAAAGAAGG - Intronic
1144100426 17:11937781-11937803 GCAGAGAAGCTGAATAAAAATGG - Intronic
1144262610 17:13537405-13537427 ATGGAGGAGCTGAGAAAGGAAGG - Intronic
1147247650 17:39132716-39132738 ATGGAGGAGCTGAGTCAAGGGGG + Intronic
1147515533 17:41114272-41114294 AAAGCGGAGCTGAAAAAGGATGG - Intergenic
1148489716 17:48015135-48015157 AAAGAGGAGGAGAAGAAAGATGG + Intergenic
1149163795 17:53726091-53726113 AGAGAGGTGCTGAACAAAGTGGG + Intergenic
1150235811 17:63591941-63591963 ATGGAGGTGCTGAATAAATTAGG + Exonic
1150536208 17:66044683-66044705 AGTGAGGAACTGAATAAAGACGG + Intronic
1151279146 17:73059172-73059194 ATAGAGAAGCTGAATATATTTGG + Intronic
1151774941 17:76194212-76194234 ATGGAGGAGTTGACTAGAGAGGG - Intronic
1154089943 18:11348970-11348992 GTAGAGGAGTTGGATAAAGATGG + Intergenic
1155102492 18:22626127-22626149 AGAGAGAAGCTGAATAGAAAAGG + Intergenic
1155365836 18:25048157-25048179 ATAGAGGAGCTGGAGGAGGATGG + Intergenic
1155798813 18:30074137-30074159 CTAGAGGAACTGAGAAAAGAGGG + Intergenic
1156729716 18:40176801-40176823 TTAGAAGACCCGAATAAAGAGGG - Intergenic
1157029626 18:43890029-43890051 ATAGAGGAGCTGGAGAGAGAGGG + Intergenic
1157040007 18:44027635-44027657 ATAGTGGAGCTGTGAAAAGAGGG - Intergenic
1157087571 18:44597244-44597266 ATATAGGAGTAGAATAAAGAAGG + Intergenic
1158423993 18:57322765-57322787 ACAGATGAGCTTGATAAAGATGG + Intergenic
1158817197 18:61116078-61116100 ATATAAGAGCTGAAACAAGAAGG - Intergenic
1159171457 18:64774134-64774156 ATAGATGAGCTGAATTATCAGGG + Intergenic
1159289829 18:66402264-66402286 ATATAGGAGCGGAATGAAAATGG - Intergenic
1159718011 18:71849460-71849482 ATAGTGGAGCTGTAAGAAGAGGG + Intergenic
925456163 2:4018377-4018399 ATAGTGGAGCTGTGAAAAGAAGG - Intergenic
926497354 2:13606909-13606931 ATAAAGGAGCTGAATATTAAAGG + Intergenic
926694590 2:15762458-15762480 ATACAGGAGGTGAATTAAAAGGG + Intergenic
926829035 2:16940169-16940191 ATGGTGGAGCTGAAGAAAGAGGG - Intergenic
926868984 2:17391650-17391672 CTAGAGGAGCTGTGAAAAGAAGG + Intergenic
927785679 2:25972856-25972878 ATAGAGGGGGACAATAAAGAGGG - Intronic
928431937 2:31227398-31227420 AAAAAGGAGATGAAGAAAGAGGG - Intronic
930180710 2:48353294-48353316 ATAGAGGAACAAAATAAACAAGG - Intronic
930449069 2:51511265-51511287 ATGGAGCAGCTGAACAGAGAGGG - Intergenic
930536079 2:52648077-52648099 ATAGTGGAGCTGTGAAAAGAAGG - Intergenic
930663423 2:54078498-54078520 ATAGAGGAGATGATGCAAGATGG - Intronic
930868995 2:56150989-56151011 AGAGAGGATCTCAAGAAAGAAGG - Intergenic
931081425 2:58776020-58776042 ATAAAGGATCAGAACAAAGATGG + Intergenic
931148035 2:59541450-59541472 ATATAGGAGTTTAATCAAGAGGG + Intergenic
931434633 2:62235974-62235996 AGTGAAGAGCTGAAAAAAGAAGG + Intergenic
932042087 2:68310355-68310377 ATAGAGCAGCTGGAGAAATAGGG + Intronic
933533315 2:83538083-83538105 AAAGATGTGGTGAATAAAGATGG - Intergenic
935239774 2:101168398-101168420 ATAGAGAAGCTGTGAAAAGAAGG + Intronic
935680428 2:105631314-105631336 GCAGAGGAGCTGAAGCAAGAAGG - Intergenic
936023063 2:109009923-109009945 ATAGAGCAGGTAAATAAAGAGGG - Intergenic
936103338 2:109602813-109602835 AGAGAGGAGCTGAAGAAAAGGGG + Intronic
936916798 2:117648355-117648377 ATAGAGAAGCTGAGAAAATAGGG + Intergenic
937109394 2:119351440-119351462 ATATAAGAGCTGAAACAAGAAGG + Intronic
937305639 2:120868864-120868886 AAAGAGGAGCTCAAGGAAGAGGG + Intronic
937560972 2:123223602-123223624 CTAGTGGAGCTGTAAAAAGAGGG - Intergenic
938735146 2:134179099-134179121 ATATAAGAGCTGAAGCAAGAAGG - Intronic
938815094 2:134894580-134894602 ATAAAAGAGCTCAATAAACAAGG + Intronic
939789554 2:146554993-146555015 ATATAGGAGGTGAATATACAAGG - Intergenic
940246332 2:151621018-151621040 ATAGAGGCTCTGAGGAAAGAAGG + Exonic
942428084 2:175880317-175880339 ATATATGTGCTGAATAAGGAAGG - Intergenic
943245253 2:185439983-185440005 ATAGAGGAACTGAAGAAATGTGG - Intergenic
943904620 2:193482563-193482585 TTAGTGGAACTGAATAAAGTTGG - Intergenic
945111248 2:206361894-206361916 ATATGGGAGCTGAAACAAGAAGG + Intergenic
946733996 2:222736187-222736209 ATAAAGAACCTGAATAAATAGGG + Intergenic
947261334 2:228226352-228226374 AAAGAAGAGTTGAATATAGAAGG + Intergenic
947954303 2:234174554-234174576 GTAGAGGAGCTGATAAAAGGGGG + Intergenic
1168958207 20:1849341-1849363 ATAGTGCAGCTGAATAAGGAGGG - Intergenic
1170066047 20:12311724-12311746 ATAGAGGAGGGGAAGAAAGGAGG - Intergenic
1170115602 20:12855692-12855714 ATAGAGGACCAGAAATAAGACGG + Intergenic
1170135329 20:13067632-13067654 ATAGAGATATTGAATAAAGATGG - Intronic
1170527127 20:17250056-17250078 TTGGGGAAGCTGAATAAAGAAGG - Intronic
1171495572 20:25552744-25552766 ATAGAGGTGCTGAACAGGGATGG + Intronic
1172601335 20:36185542-36185564 ATAGAGGAGCTTAAGAAACTTGG - Intronic
1173185034 20:40834024-40834046 ATGGAGGAGGTGAAGAGAGAGGG + Intergenic
1173393723 20:42658512-42658534 GTAGGGGAGCTGAAACAAGAAGG + Intronic
1176274580 20:64256488-64256510 AAAGAGGGGGTGGATAAAGAGGG - Intronic
1177855653 21:26397775-26397797 ATAGAGTGGCTGCATTAAGAGGG + Intergenic
1179146213 21:38770030-38770052 AAATAGGAGCTGAATAATTAGGG - Intergenic
1179415898 21:41198524-41198546 GTAGAGGAGCTTATTAAAGAAGG - Intronic
1181077275 22:20389257-20389279 AAAAAGGAGCTGTTTAAAGAAGG + Intronic
1181662280 22:24361020-24361042 AAGGATGAGCTTAATAAAGATGG - Intronic
1182524861 22:30908705-30908727 AGAGAGGACCTGAGTTAAGAGGG + Intergenic
1185198473 22:49487908-49487930 AAAGAGGAGAGGAAAAAAGATGG - Intronic
949555167 3:5146428-5146450 ATAGAGGAATTAATTAAAGATGG - Intronic
949908945 3:8884172-8884194 ATAGAGGAACTGGAGAGAGAAGG + Intronic
950252184 3:11475080-11475102 ATAGAGGAGTAGAAATAAGAAGG + Intronic
950721382 3:14885143-14885165 CTAGAGGAACTGAACAAAGGGGG - Intronic
951904144 3:27687765-27687787 AGAGAGGAGGTGGAGAAAGATGG + Intergenic
952563062 3:34618509-34618531 ATAGAGAAGCTGAATGAATAAGG - Intergenic
952874385 3:37931120-37931142 AAAGAGGAGCTGAATAGAGGGGG - Intronic
953043730 3:39277506-39277528 ATGGAGGAGCTGAACAAGGAGGG - Intronic
953094481 3:39761508-39761530 TTAGAGGAGCTGAACAGAGAAGG + Intergenic
953485987 3:43296567-43296589 GTAGAGGAGTTGAACAAAAAGGG - Intronic
953549444 3:43890001-43890023 TTGGAGGAGCTGAAGGAAGAAGG - Intergenic
955546998 3:60041625-60041647 AGAGATGATCTGAATAAAGAAGG + Intronic
955796071 3:62638509-62638531 ATAGAGAAGCTGAATCAGAAAGG + Intronic
955942666 3:64161163-64161185 ATAGAGTAGTTGAATAATCAAGG - Intronic
956534499 3:70260663-70260685 AGAGAACAGCTGTATAAAGAGGG - Intergenic
957117551 3:76046076-76046098 AAGCAGGAGCTGGATAAAGATGG - Intronic
958759981 3:98295614-98295636 ACAGAGGAGGTGAAGCAAGATGG + Intergenic
960517487 3:118618202-118618224 ATAGAGTAGGGGAAGAAAGAGGG + Intergenic
960660428 3:120052100-120052122 TTAGAGAAGTTCAATAAAGAGGG + Intronic
961545958 3:127633373-127633395 ATAGAGGAGCTGAAATTAGCTGG - Intronic
961545970 3:127633510-127633532 ATAGAGGAGCTGAAATTAGCTGG - Intronic
962384299 3:134920638-134920660 ATGGAGGAGCTGTAAAAAGAGGG + Intronic
963090551 3:141479709-141479731 AAAACGGAGTTGAATAAAGAAGG + Intergenic
963640176 3:147851429-147851451 AGAGAGGAGTCAAATAAAGAAGG - Intergenic
965776679 3:172239195-172239217 ATAGAGGTGCTGAGTGGAGAGGG + Intronic
965999437 3:174929415-174929437 TTAGAGGAGGAGAATAAGGAAGG - Intronic
966474700 3:180330726-180330748 AAAGAGGAGGAAAATAAAGAAGG + Intergenic
969213191 4:5703815-5703837 ACAGTGGAGCAAAATAAAGAAGG + Intronic
970539968 4:17067836-17067858 ACAGAGGAGCTTAATGAAGAGGG - Intergenic
970842045 4:20485080-20485102 ATTGAGGTGTTGACTAAAGAAGG - Intronic
971055864 4:22911601-22911623 ATAGATGCACAGAATAAAGAAGG + Intergenic
971226648 4:24759786-24759808 TTAGAGGAGAACAATAAAGATGG + Intergenic
972372769 4:38440706-38440728 ATAGAGGAGGATAAAAAAGAAGG + Intergenic
972646820 4:40976146-40976168 ATAGAGGAGAGAAATAATGAAGG - Intronic
974699374 4:65419581-65419603 AAAGAGGAGCTAAAGATAGATGG - Intronic
974770816 4:66409984-66410006 AAAAAGCAGCTTAATAAAGAAGG + Intergenic
976212984 4:82690959-82690981 ATAAAGGAGCTGAACAAAGGAGG + Intronic
976417280 4:84792273-84792295 ATATAGGAACTGAATAAACTAGG + Intronic
977905389 4:102472138-102472160 ATAGAGGAACTAGATAAAAAAGG + Intergenic
978219551 4:106255145-106255167 ATAGAAGACCTAAATAAATATGG - Intronic
978633033 4:110769113-110769135 AAGGAGGTGCTCAATAAAGAAGG - Intergenic
979039032 4:115763517-115763539 CTAGAGGAGCTGACTCCAGAAGG - Intergenic
980442396 4:132866478-132866500 ATAGGGGAGGTGGAGAAAGATGG + Intergenic
982833467 4:160092249-160092271 ATAAATGAATTGAATAAAGATGG + Intergenic
982869302 4:160556124-160556146 ATAAATGAGCTGAATAACAATGG + Intergenic
983483554 4:168305840-168305862 ATGGAGAAGGTCAATAAAGAAGG - Intronic
983857055 4:172659497-172659519 AAAGAGGGGCTGCTTAAAGAAGG - Intronic
984570888 4:181392129-181392151 ATAGAGGAAATGAATAGAAAGGG - Intergenic
986949909 5:13070743-13070765 CTAGTGGAGCTGAAAGAAGAGGG - Intergenic
987125842 5:14811866-14811888 GTAGAAGAACTGAATAAAGGTGG - Intronic
987161820 5:15152631-15152653 CTAAAGGTGCTCAATAAAGAAGG - Intergenic
990902774 5:60771150-60771172 ATAGAGGAAGTTAATAAAAAAGG + Intronic
992681847 5:79161327-79161349 ATGTAGGAGCTGAAAAAAAAAGG + Intronic
993650185 5:90510507-90510529 AAAGTGGAGATGAATAAGGAAGG - Intronic
994106673 5:95957703-95957725 ATAGGGAACCTGAATAATGAAGG + Intronic
994147168 5:96408505-96408527 ATAGAGAAGTTGCATATAGAGGG - Intronic
996566405 5:124883609-124883631 AAGGAGGAGCTGCATCAAGAGGG - Intergenic
997064688 5:130547101-130547123 ATAGAGGAATTGATTAAAGATGG - Intergenic
997896896 5:137726994-137727016 ATAGAGGAGGGCAAGAAAGAAGG - Intronic
999477733 5:151916706-151916728 ATAAAGGAGGTGAATCAAGATGG - Intronic
1000132621 5:158314366-158314388 ACAGAGGAGGTAAATAAAGGAGG - Intergenic
1000232210 5:159326694-159326716 ATATGGGAACTGAAGAAAGATGG - Exonic
1002891519 6:1336704-1336726 ATAGAAGAGGTCAAGAAAGATGG + Intergenic
1004083438 6:12419735-12419757 ACACAGGAGCTAAATAAAAATGG + Intergenic
1004855790 6:19748419-19748441 ATAGTGGAGCTGAGAATAGAAGG + Intergenic
1007061474 6:38944892-38944914 AAAGAGGGGGGGAATAAAGAAGG - Intronic
1008467471 6:51846861-51846883 AGAGAGAGGCTGAATTAAGACGG - Intronic
1009319822 6:62273884-62273906 ATAGAGGGGCTGAAAAATAAAGG - Intronic
1009609974 6:65929254-65929276 ATGGAGGATATGAATAAAAATGG + Intergenic
1010140170 6:72605007-72605029 TCCAAGGAGCTGAATAAAGAGGG - Intergenic
1010155523 6:72787781-72787803 ATAGAGGAGCTGATTAAGTTTGG - Intronic
1011301174 6:85875813-85875835 ATAGACCAGCCTAATAAAGAAGG - Intergenic
1011923321 6:92610312-92610334 AAAGAGGAGGAGAAGAAAGACGG - Intergenic
1012732372 6:102899347-102899369 ATAGTGGAGCTGAGAGAAGAAGG - Intergenic
1014554879 6:122833655-122833677 ATGGAGGAGGGGAGTAAAGAAGG + Intergenic
1014721240 6:124920629-124920651 ATAGTGGAGCTGTGAAAAGAGGG - Intergenic
1015529374 6:134206234-134206256 ACAGAGGAGTTGAATAAAGTGGG - Intronic
1016368734 6:143347703-143347725 AAGGAGGAGCTGTAAAAAGAAGG + Intergenic
1016500540 6:144715616-144715638 GTAGAGAAGTTGAGTAAAGAAGG - Intronic
1017144723 6:151224330-151224352 ATAGAGGAAGTGATTAAAGATGG + Intergenic
1017534340 6:155330416-155330438 ATAGAGGAGATGACTGGAGAAGG + Intergenic
1017640702 6:156490976-156490998 ATAGTGGAGCTGTGAAAAGAGGG + Intergenic
1017668458 6:156745350-156745372 AAAGAGGATGTGAGTAAAGAGGG + Intergenic
1019050999 6:169183542-169183564 ATACAGTAGGTGATTAAAGAGGG - Intergenic
1021300847 7:18971282-18971304 ATAGAGGATATGACTGAAGAGGG + Intronic
1021459844 7:20873817-20873839 ATAGGGGAGCAGAATAAAGGGGG + Intergenic
1021924636 7:25522365-25522387 ATAGAAGAGCTTAATCAACAAGG + Intergenic
1025910779 7:65826700-65826722 ATAGAGGATCAGCATAATGAGGG - Intergenic
1026653784 7:72238687-72238709 ATAGAGGTGCAGAGCAAAGAGGG - Intronic
1027424142 7:78045584-78045606 AAAAAGAAGCTGAATAATGATGG + Intronic
1028489579 7:91396031-91396053 ATAAGGTAGCTGAATAAATAGGG - Intergenic
1028661307 7:93279399-93279421 ATAGAGGAGCTGAATAAAGAAGG + Intronic
1030015282 7:105213204-105213226 ATAGAGCAGGTGGATGAAGAAGG + Intronic
1030581213 7:111358248-111358270 ATTGAGGAGCTGAGAATAGAGGG - Intronic
1031697714 7:124879178-124879200 ATCCAGGAGGTGAACAAAGATGG + Intronic
1034088710 7:148344410-148344432 ATAGAGGAGGTGATTGGAGAAGG - Intronic
1036067106 8:5393348-5393370 ATAAAGGAAGTGAATAAAGAAGG + Intergenic
1037846984 8:22292167-22292189 ATGGAGGAGCTGATTACACAGGG + Intronic
1037861816 8:22410791-22410813 ATAGAGGAGCTATAAAAATAAGG + Intronic
1039147039 8:34459573-34459595 ATAGATGAGATAAATAAAAAAGG - Intergenic
1039390161 8:37173490-37173512 ATAGCGGAGATGCAGAAAGATGG + Intergenic
1039751954 8:40486603-40486625 AAAGAGGAGGGGAAGAAAGAAGG - Intergenic
1039794631 8:40902348-40902370 GTAGGGGAGCTGAATTAAGAAGG + Intergenic
1040626677 8:49157676-49157698 ATAGGGGAGCAGAGTAAGGAGGG + Intergenic
1041187873 8:55320646-55320668 TTAGTGGAGATGAAAAAAGAAGG - Intronic
1042155019 8:65835503-65835525 AAAGAAGAGCTGAAGAAAGGGGG - Intronic
1042415694 8:68515313-68515335 ATAGAGCAGCTGGAGAAAGAAGG - Intronic
1042960551 8:74299243-74299265 AAAGACGAGGTGAATAAAGAAGG - Intronic
1042963563 8:74327890-74327912 ATAAAGCAGTTGCATAAAGAAGG + Intronic
1043068338 8:75604994-75605016 ATTGAGGATATGAATAATGAAGG - Intergenic
1043139308 8:76568716-76568738 AAAGAGGAGATGGAGAAAGAGGG - Intergenic
1043817738 8:84823791-84823813 ATAGAGAAGCTGAAAGAAGGAGG - Intronic
1045088912 8:98718284-98718306 ATATTTGAGTTGAATAAAGAAGG + Intronic
1046224624 8:111261642-111261664 ATAAAGAAGCTGAGGAAAGACGG - Intergenic
1047408434 8:124604612-124604634 ATACAGTAGCTGAATAAAACAGG - Intronic
1047601375 8:126429174-126429196 ATAGAGGGGCAAAATAAATAAGG + Intergenic
1048572847 8:135669438-135669460 AGAGAGGAGCTGAGCAGAGAAGG - Intergenic
1048732603 8:137460536-137460558 AGAGAGGAGGAGAAGAAAGAGGG - Intergenic
1049051084 8:140197151-140197173 AAAGAGGAGGAGAATAAAGTGGG + Intronic
1049170269 8:141156004-141156026 ATACAGAATCTGAACAAAGACGG - Intronic
1050655258 9:7821376-7821398 ATAAATGAGATGAAGAAAGATGG + Intronic
1050838741 9:10118904-10118926 ATAAAGGAGATGAAGGAAGAGGG + Intronic
1051961964 9:22777163-22777185 ATAAAGGAGAAGAATAAAGTTGG + Intergenic
1052193451 9:25684020-25684042 TTAGTGGAGCTGCAGAAAGAGGG + Intergenic
1053003944 9:34592184-34592206 ATAGGGGCGCTTAATAAAGGTGG - Intergenic
1055533104 9:77207442-77207464 ATAGAGAAGATGAAAAAATAGGG - Intronic
1056124335 9:83520432-83520454 AGAGAGGAATTGAGTAAAGATGG - Intronic
1057574615 9:96232271-96232293 CTATAAGAGCTGAATAAAAAAGG + Intergenic
1057740923 9:97710568-97710590 ACAGAGGAGCGGAAGAAACAGGG + Intergenic
1058204024 9:102079534-102079556 ATAGAGAGGATAAATAAAGAGGG - Intergenic
1058316175 9:103569481-103569503 AAAGAGGAGATGAATAAAATTGG - Intergenic
1058597714 9:106632650-106632672 ATAGAGGATCTCAAGAGAGAAGG - Intergenic
1062201533 9:135305499-135305521 TGAGAGGAGCTGATTAAAGCAGG + Intergenic
1186492886 X:9988387-9988409 AAATATGAGCTGGATAAAGATGG + Intergenic
1187279950 X:17850571-17850593 TCAGAAGAGCTGAGTAAAGAAGG + Intronic
1189065923 X:37808873-37808895 ATAGAGGAGGTTAAGAAAGGTGG - Intronic
1189676729 X:43468203-43468225 AGAGGGGAGCTGAAGAGAGAAGG + Intergenic
1189848406 X:45157023-45157045 AGAGAGGAGCTGGAAAAGGAGGG - Intronic
1191915419 X:66196306-66196328 ATAGAGTAGATAAATAAAGATGG + Intronic
1192617004 X:72635931-72635953 ATTTAGTAGCTGAATAAAAAAGG + Intronic
1193239656 X:79152754-79152776 ATAGAGAAACTGAAAAATGAGGG - Intergenic
1193780095 X:85690892-85690914 ATAGAGGTCCTGAATAATTATGG - Intergenic
1194578448 X:95641784-95641806 ATAGTGGAGCTGTTAAAAGAGGG - Intergenic
1196725057 X:118888172-118888194 ATAGAGGGATTGATTAAAGATGG + Intergenic
1197230539 X:123999273-123999295 ATGGTGGAGCTAAATAAAAAAGG - Intronic
1197836756 X:130702788-130702810 ATAGAGGAGGCAAATAAACATGG - Intronic
1197904355 X:131408684-131408706 AAAGTGGAGCTGAAAACAGAGGG + Intergenic
1198013557 X:132585222-132585244 ATGGAGGAGAAGATTAAAGAGGG - Intergenic
1198170468 X:134100338-134100360 ATTAGGGAGCTGGATAAAGAGGG + Intergenic
1199306500 X:146272954-146272976 GAAGAGGAGGTGAATCAAGAAGG - Intergenic
1200538402 Y:4428141-4428163 ATAGAAAAGCTAAATAAAGCTGG - Intergenic