ID: 1028662921

View in Genome Browser
Species Human (GRCh38)
Location 7:93302202-93302224
Sequence GCTATGAGCACAGTCACTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028662919_1028662921 8 Left 1028662919 7:93302171-93302193 CCACTTGAGGTAATTTTTGTATG 0: 1
1: 5
2: 51
3: 192
4: 564
Right 1028662921 7:93302202-93302224 GCTATGAGCACAGTCACTTTTGG No data
1028662917_1028662921 23 Left 1028662917 7:93302156-93302178 CCTTAGGATTGTGATCCACTTGA 0: 1
1: 0
2: 0
3: 13
4: 100
Right 1028662921 7:93302202-93302224 GCTATGAGCACAGTCACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028662921 Original CRISPR GCTATGAGCACAGTCACTTT TGG Intronic
No off target data available for this crispr