ID: 1028664644

View in Genome Browser
Species Human (GRCh38)
Location 7:93327308-93327330
Sequence CACGTGTGACTACTATCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 43}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028664642_1028664644 14 Left 1028664642 7:93327271-93327293 CCAATTTTAGTTAATTTAATCTT 0: 1
1: 0
2: 8
3: 102
4: 1103
Right 1028664644 7:93327308-93327330 CACGTGTGACTACTATCATATGG 0: 1
1: 0
2: 0
3: 1
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028664644 Original CRISPR CACGTGTGACTACTATCATA TGG Intronic
913393963 1:118345811-118345833 CACTTGTGTCCACTCTCATATGG - Intergenic
916506488 1:165432944-165432966 CACCTGTTACTACTCTCTTATGG - Intronic
1067685268 10:48463175-48463197 CAAGTGTGAGTCCTATCAAAAGG - Intronic
1069259160 10:66372387-66372409 CACCTGTGACTAGCCTCATATGG - Intronic
1072997102 10:100255171-100255193 CAGGAGTGACAACTATCATGGGG - Intronic
1086327346 11:85716785-85716807 TAGCTGTGACTACTATCTTAAGG - Intronic
1087141985 11:94773520-94773542 CATGTGTTACTACTATGATGGGG + Intronic
1102333535 12:112057287-112057309 CAGTTGTTACTATTATCATATGG + Intronic
1109234691 13:59800934-59800956 AATGAGTGACTACTATCAAAAGG + Intronic
1110277757 13:73659083-73659105 CACCTCTTACTACCATCATATGG + Intergenic
1114864439 14:26571507-26571529 CCCATGTGACTCATATCATATGG - Intronic
1116450060 14:45054588-45054610 CAAATGAGACTACTATCACAAGG - Intronic
1117566652 14:57000369-57000391 AACTTGTGACTACTGCCATAAGG - Intergenic
1121218477 14:92266727-92266749 CACTTCTGCCTACTAACATAGGG + Intergenic
1121625755 14:95384470-95384492 CACCTGAGACTATCATCATATGG + Intergenic
1136866078 16:33755783-33755805 GACCTGTGACTACAATCAGAAGG + Intergenic
1203106075 16_KI270728v1_random:1360320-1360342 GACCTGTGACTACAATCAGAAGG - Intergenic
1203127439 16_KI270728v1_random:1602048-1602070 GACCTGTGACTACAATCAGAAGG + Intergenic
1144609737 17:16699964-16699986 TACATGTGACTACAATCAGAAGG - Intronic
1144903005 17:18615453-18615475 TACATGTGACTACAATCAGAAGG + Intergenic
1149130377 17:53293911-53293933 CACATGTGAGTGCTATCATGTGG + Intergenic
1166540590 19:43602827-43602849 CATGTCTGAATACTATCACATGG - Intronic
934799039 2:97132573-97132595 GACCTGTGACTACGATCAGAAGG - Intronic
934834399 2:97570897-97570919 GACCTGTGACTACGATCAGAAGG + Intronic
1173877118 20:46380348-46380370 CACCTGTGACTACTATCGAGAGG + Intronic
959234050 3:103694885-103694907 GAAGAGTGACTTCTATCATATGG - Intergenic
961271075 3:125689164-125689186 CTAGTGTGAATACTATCACAGGG + Intergenic
964323794 3:155525285-155525307 CACCTCTTAATACTATCATATGG - Intronic
967243151 3:187460975-187460997 AAAGTGTGACTATGATCATAGGG - Intergenic
967409489 3:189152983-189153005 CACGTGAAACTACTTTCATAAGG - Intronic
972707329 4:41557999-41558021 CACGTGTGGCCACTGTGATAAGG - Intronic
975126296 4:70786164-70786186 CACGTATGAGTGTTATCATATGG - Intronic
984164023 4:176286503-176286525 TACGTGGGACTCCTATCAGAAGG - Intergenic
998896363 5:146804365-146804387 CAGGTGTCACTACTAGCATCTGG + Intronic
1000361606 5:160452851-160452873 CACGTATATCTACTTTCATATGG + Intergenic
1004230850 6:13831716-13831738 CCTGTGTGACTAATAGCATATGG + Intergenic
1008721698 6:54361629-54361651 AATGTGTGACTACTCTGATATGG - Intronic
1028664644 7:93327308-93327330 CACGTGTGACTACTATCATATGG + Intronic
1039031343 8:33312863-33312885 CACATGTGACTCCGATCATTTGG - Intergenic
1044232445 8:89794905-89794927 GACATGTGACTACTATAAAACGG - Intergenic
1045823924 8:106374002-106374024 CACGAGTGACTTCTGTAATACGG - Intronic
1053055819 9:34992575-34992597 CACGTGTGACTCAGATCACAGGG - Intronic
1193589583 X:83371739-83371761 CACCTCTTAATACTATCATATGG + Intergenic
1194240381 X:91437717-91437739 CACCTGTGAATATTATCAAAAGG - Exonic
1202585905 Y:26426811-26426833 GACCTGTGACTACAATCAGAAGG - Intergenic