ID: 1028676184

View in Genome Browser
Species Human (GRCh38)
Location 7:93464580-93464602
Sequence ATAAAGTCTCTTGTCAAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 236}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028676184 Original CRISPR ATAAAGTCTCTTGTCAAATA GGG (reversed) Intronic
906084932 1:43123799-43123821 TTATAGTCTTTTATCAAATATGG + Intergenic
906885722 1:49645640-49645662 ATAAAATCTCTTTTTAAAAATGG + Intronic
908579687 1:65501554-65501576 ATAGAGCCTATTTTCAAATAAGG + Intronic
908890215 1:68838011-68838033 ATAAAGACTCTTCAGAAATATGG - Intergenic
909771238 1:79424790-79424812 AAAAATTCTATTGCCAAATAAGG + Intergenic
910248919 1:85173110-85173132 GTAAAGACTCTTTCCAAATAAGG - Intronic
911674620 1:100645820-100645842 ATAAACTCTCTTGCCATCTAGGG + Intergenic
913076737 1:115346524-115346546 AGCAAGCCTCTTGTCAAATAAGG - Intergenic
918796939 1:188911447-188911469 ATAATGTTTTTTGTCAAATCTGG - Intergenic
921061362 1:211587770-211587792 CAAAAGTCTCTTCCCAAATAAGG - Intergenic
921096449 1:211890768-211890790 ATGAAGAGTCTAGTCAAATAAGG + Intergenic
923674364 1:236066770-236066792 CTGCAGTCTGTTGTCAAATATGG + Intergenic
924167944 1:241304992-241305014 CTGAAGTTTCTTGTCAAATTAGG - Intronic
1063244403 10:4203535-4203557 ATAATGTCCCTTGACAAATTAGG + Intergenic
1065165272 10:22970224-22970246 ATAAATTGTCTGGTCAAAGAAGG + Intronic
1065234568 10:23635990-23636012 ATAAAGTCCCTTACTAAATATGG - Intergenic
1065819577 10:29513029-29513051 ATAAAGTCCCTTTTCTAAGATGG + Intronic
1067974200 10:51005845-51005867 AGAAAGGCTTTTGTGAAATAAGG - Intronic
1068320951 10:55415094-55415116 ATAAAGTCTCTTGTTAAATTAGG - Intronic
1068658173 10:59595575-59595597 ACAAGGCCTCTTTTCAAATATGG - Intergenic
1069055112 10:63836837-63836859 ATAACGTCTCTTCTCAGAAAGGG + Intergenic
1069414812 10:68189035-68189057 CTTGAGTCTCTTGTCAAAGATGG - Exonic
1070351490 10:75597072-75597094 AAAAACTCTCTAGCCAAATAAGG - Intronic
1071180038 10:82973265-82973287 ACAAATTCTCTTGTTAAACATGG + Intronic
1072361858 10:94667210-94667232 ATAAAGTTTTTGGTAAAATAAGG + Intergenic
1073402385 10:103269073-103269095 ATAAGGTCTCTAGTGAATTAAGG - Intergenic
1073886722 10:108048368-108048390 AGACAGTCTCTTCTCTAATAAGG - Intergenic
1074089661 10:110237368-110237390 ATAAAAACTCTTAGCAAATAAGG - Intronic
1077808858 11:5617071-5617093 GTACAGGCTCTTGTCAAATAAGG + Intronic
1080117009 11:28632450-28632472 AAAAAATCTCTTGTAAAATGTGG - Intergenic
1080171010 11:29302686-29302708 ATAAAGTTTCTTTTGAAATATGG + Intergenic
1080172120 11:29317327-29317349 ATAAAATCTTTTGTAAAATAAGG - Intergenic
1080919598 11:36695877-36695899 ATAAAGGCTATTATCAAATGCGG - Intergenic
1080980705 11:37401935-37401957 GGAAAGTCTCATTTCAAATAAGG - Intergenic
1083013990 11:59432618-59432640 ATAAAGACTCTTGGCAAACTAGG + Intergenic
1083373926 11:62204711-62204733 ATTAAGTCTCCTGTCCAATGTGG + Intergenic
1086410003 11:86535522-86535544 ATAAAGTTACTTTGCAAATAAGG + Intronic
1087514785 11:99144374-99144396 ATAACTTCTCTTATGAAATATGG - Intronic
1087563215 11:99817779-99817801 ATAAAGTCTCCTTTAAAACATGG - Intronic
1088230349 11:107667934-107667956 TTTAAGCCTCTTTTCAAATATGG - Intergenic
1090235913 11:125146977-125146999 ATAAAGTCTCTTGACCACTTTGG + Intergenic
1094232008 12:28116551-28116573 ATAAAGTCTCTTTTGAATTTTGG - Intergenic
1095718776 12:45377389-45377411 ATAACGTATCTGGCCAAATAAGG - Intronic
1096449528 12:51726433-51726455 ATAAAGTAACTTGTCCAAGATGG + Intronic
1097460003 12:59850073-59850095 ACAAAGGCTCTTTTCAGATAGGG + Intergenic
1097460019 12:59850191-59850213 ACAAAGGCTCTTTTCAGATAGGG + Intergenic
1097699998 12:62810168-62810190 ATACAGTAGCTTGGCAAATAGGG + Intronic
1098124894 12:67280742-67280764 ATAGAGTCTCAGGTAAAATAAGG - Intronic
1098811582 12:75101074-75101096 AAAAAGTCTCATGTCCAAAATGG - Intronic
1099845173 12:88019540-88019562 ATAGAGTCTCTTGTTACATTTGG + Intronic
1104226579 12:126840787-126840809 ATAATAGCTCTTGTCATATAGGG - Intergenic
1105249921 13:18689218-18689240 AAAGATTCTCTTTTCAAATAAGG - Intergenic
1105448039 13:20474496-20474518 ATTATGCATCTTGTCAAATAGGG - Intronic
1106299838 13:28453459-28453481 ATACATTCTCTTGGTAAATATGG + Intronic
1107210542 13:37849019-37849041 AGCAAGTCTCTTGTCACATCTGG - Intronic
1107468615 13:40670383-40670405 AAAATGTCTCATGTCAAGTAAGG + Intergenic
1108079776 13:46723169-46723191 ATATAGTGCCTTGTCACATAGGG - Intronic
1108356612 13:49634129-49634151 AAAAAGTCACCTGTCACATATGG - Intergenic
1109334575 13:60976918-60976940 ATAAGGTCTCTTGTTAATTCAGG - Intergenic
1110764226 13:79264418-79264440 ATAACTTCTCTTCTTAAATATGG - Intergenic
1111207177 13:85026688-85026710 ATTAAGTATCTTGTTAACTATGG + Intergenic
1112240928 13:97680282-97680304 ATAAAGTCTCTTAAGAAAAAGGG - Intergenic
1112839951 13:103563795-103563817 CCAAAGTCTCTTCTGAAATAAGG + Intergenic
1112905048 13:104407475-104407497 ATTTAATCTCTTGACAAATATGG - Intergenic
1113714093 13:112490559-112490581 TTTAATTCACTTGTCAAATATGG + Intronic
1115378674 14:32708215-32708237 ATAAACTCTCCTGCCAACTATGG - Intronic
1116555775 14:46305014-46305036 ATAAAGTCGCATGGCAAAAATGG - Intergenic
1116773808 14:49157058-49157080 ATAATGTCTCTTGACAACTCTGG + Intergenic
1117410154 14:55443104-55443126 ATAAAGTCTCTCATCATATGTGG + Intronic
1118067312 14:62206301-62206323 ATAAAGTCTTTTTTTAAATAAGG + Intergenic
1118973833 14:70660450-70660472 AGAAAGTCACTTATCAAATATGG - Intronic
1121478039 14:94231372-94231394 AAAAGGTTTCTTGTCAAAAATGG + Intronic
1124252360 15:28115210-28115232 ATACACTGTCTTGTCAGATAAGG - Intronic
1124622561 15:31283107-31283129 ATAAAGTCTCTTTTTAAAAAAGG - Intergenic
1126551013 15:49929453-49929475 CTAAAGTTTTATGTCAAATATGG - Intronic
1127889072 15:63231822-63231844 ATAAAGTCTCTTTTCATAAAGGG - Intronic
1129415086 15:75372001-75372023 AACAAGTATCGTGTCAAATACGG - Exonic
1131419590 15:92294051-92294073 ATGAAGTCACTGGTCAAATGTGG + Intergenic
1134436006 16:14257802-14257824 ATAAAGACACTTTTAAAATAAGG + Intronic
1136671375 16:31861613-31861635 ACAAAGTCTCTTGCCAACTCAGG + Intergenic
1136872278 16:33818155-33818177 ATAAAGGATATTGGCAAATAAGG + Intergenic
1139181783 16:64756778-64756800 ATACAGTCTATTTTCAAATACGG - Intergenic
1139187727 16:64826774-64826796 ACAAAGTCTATGGTCAAAAAGGG - Intergenic
1140343753 16:74191935-74191957 TTAATGTCTATAGTCAAATAAGG - Intergenic
1140574802 16:76154956-76154978 ATATATTCTTTTGTTAAATAGGG - Intergenic
1140934149 16:79655067-79655089 ATAAAGTCACCTGTCTAATGTGG - Intergenic
1203099894 16_KI270728v1_random:1297913-1297935 ATAAAGGATATTGGCAAATAAGG - Intergenic
1143977634 17:10841967-10841989 ATAAAGTATCTTGACCAATGTGG - Intergenic
1145015720 17:19396561-19396583 CTTATGTCTCTTGTCAAATTTGG + Intergenic
1147499775 17:40951626-40951648 ATGAAGGCTTTTGTCAAAAATGG + Intergenic
1150610522 17:66729693-66729715 TTAATGTCTCTGGTCAAATGGGG + Intronic
1150965813 17:69967305-69967327 ATGAAGTATCTCATCAAATAAGG + Intergenic
1154438906 18:14369678-14369700 AAAGATTCTCTTTTCAAATAAGG + Intergenic
1155663092 18:28275343-28275365 TTAAATTTTCTTGTCAACTATGG - Intergenic
1156074199 18:33253227-33253249 ACAAAGTCTGTTAACAAATATGG + Intronic
1156893715 18:42218832-42218854 AAAAAGTCTCTTCTTAAAAAAGG - Intergenic
1158730947 18:60021926-60021948 ATAAAGTCTTTCTTTAAATAAGG - Intergenic
1159210881 18:65319635-65319657 TTAAAGCCTCTTTTCAAAAAGGG + Intergenic
1160335659 18:78036517-78036539 TAAAAGTGTCTTTTCAAATATGG + Intergenic
1160557574 18:79736077-79736099 ATAAAGTCCCTGTTCACATAAGG + Intronic
928621033 2:33088143-33088165 AAGAAGTCTCTTGTTAAATATGG + Intronic
929263900 2:39896952-39896974 ATAAAGTCTGTTGACCAATTAGG + Intergenic
929323333 2:40573658-40573680 ATAAAGTATTTTTTCAATTAAGG + Intronic
931295859 2:60924605-60924627 ATAAAATCTCTTTTCATAAAAGG - Exonic
932960453 2:76406885-76406907 TTGAAGGATCTTGTCAAATAGGG + Intergenic
934016134 2:87885312-87885334 ATAAAGTCTATTAACAAATTAGG + Intergenic
934861270 2:97765196-97765218 AGAAAGTCTCATGGCAAATAGGG + Intronic
936290347 2:111218093-111218115 TTAATGTCTTTTGTCAAATTTGG + Intergenic
938915676 2:135936743-135936765 ACAAAGTCATTTGTCAAATTAGG + Intronic
939347015 2:140978556-140978578 TTATAGTATATTGTCAAATAGGG + Intronic
939418619 2:141935519-141935541 ATATAGAATCTTGTAAAATAAGG + Intronic
939866874 2:147482552-147482574 ATAAAGTCTCTAAGCAAATGAGG + Intergenic
942406914 2:175665898-175665920 ATAACACCTCTGGTCAAATATGG + Intergenic
943081100 2:183260239-183260261 ATAAATTTTCTTGTCACAAATGG - Intergenic
943559120 2:189440556-189440578 ATATAGTCACATGTCACATAAGG - Intergenic
943815085 2:192243685-192243707 ATATAGTGTCTTCTCAAATTTGG + Intergenic
947889022 2:233599977-233599999 ATAAATTTTTTTGTCAGATATGG + Intergenic
948337355 2:237220416-237220438 AAAAAGTATCTTTTCAAATGAGG + Intergenic
1170182249 20:13545018-13545040 AAAAAATCTCATGTTAAATAAGG - Intronic
1173056682 20:39621405-39621427 ATAAAGGGTCTGTTCAAATATGG + Intergenic
1173189861 20:40867924-40867946 AGAAACTCTCTTATTAAATAAGG + Intergenic
1176456777 21:6919754-6919776 AAAGATTCTCTTTTCAAATAAGG - Intergenic
1176834950 21:13784814-13784836 AAAGATTCTCTTTTCAAATAAGG - Intergenic
1176971340 21:15269405-15269427 GTAAATTCTCTTGTCAAACAAGG + Intergenic
1177434573 21:21034258-21034280 GTGAAATCTCTTGTGAAATATGG - Intronic
1182036305 22:27201114-27201136 ATAAAGCCTCTGGTCAGATGAGG + Intergenic
1183970076 22:41470034-41470056 AATAAGTTGCTTGTCAAATATGG + Intronic
949135831 3:564065-564087 ATAATGTCTCATTTTAAATAAGG + Intergenic
949601349 3:5601431-5601453 ATAAAGTCTCTTAAGAATTATGG + Intergenic
949635289 3:5975572-5975594 ATAAAGTCTCCTGTCAGGTATGG - Intergenic
950134965 3:10574641-10574663 ACAAAGTCACTTGTAAAACATGG + Intronic
950919045 3:16675298-16675320 ATGAAGTCTCCTCTCAAAGAAGG + Intergenic
951295246 3:20925624-20925646 ATAAAATTACTTGACAAATAAGG + Intergenic
951863381 3:27278852-27278874 ATACTGTCACTTGCCAAATAAGG - Intronic
952167256 3:30763898-30763920 ATAAAATCATTTTTCAAATATGG - Intronic
955118921 3:56036166-56036188 ATAAAGACTCTCGACAAATTGGG + Intronic
957617140 3:82544784-82544806 GTAAAATGTCTTGTCTAATATGG - Intergenic
957964862 3:87309131-87309153 TTAAAGACTGTTGTCAAATTGGG + Intergenic
958093929 3:88915781-88915803 ATAAAGTCTATTTTTAACTACGG - Intergenic
960391172 3:117079266-117079288 ATAAGTTCTCTTGTCACATTTGG + Intronic
963291524 3:143494897-143494919 ATAAAATCTCTTTTCCAATACGG - Intronic
964886031 3:161484140-161484162 ATAAAGTTTCTTTTCTAATATGG - Intergenic
965413373 3:168361022-168361044 CTAACTTCTCTTGTAAAATAAGG - Intergenic
965659111 3:171022025-171022047 GTAAAGTCTTTTGCCACATAAGG + Intronic
965887736 3:173469269-173469291 CTAAAATCTCTTTTCAAAGAGGG + Intronic
966309042 3:178573430-178573452 ATCAAATCTTTGGTCAAATACGG - Intronic
971226428 4:24757025-24757047 TTAATGTCTCTTATCAAATTTGG + Intergenic
972384290 4:38549119-38549141 ATAAAATCTCCTCTGAAATATGG - Intergenic
976036648 4:80831090-80831112 AGACAGTCTCTTCTCAAATTGGG + Intronic
976228850 4:82819740-82819762 ATAAAGTCTTCTGTAAAGTATGG - Intronic
976548565 4:86366828-86366850 CTAAGGTCTCTTGTCAAAAGAGG + Intronic
976942507 4:90720928-90720950 ATGAAATCGCTTGTCAATTAAGG + Intronic
978611637 4:110546998-110547020 GTATAGTGTCTTGTCAAACATGG - Intronic
978815338 4:112898043-112898065 ATAAAGTCTATTGATAAAGATGG - Intronic
978818295 4:112934222-112934244 TTTAAGTGTCTTGTAAAATAAGG + Intronic
979135384 4:117105216-117105238 AAAGACTCTATTGTCAAATAAGG - Intergenic
980834030 4:138167986-138168008 AGAAAGTCACTTGTTATATATGG + Exonic
982422484 4:155213688-155213710 AATAAGTCTATTGTCAAATATGG - Intronic
983929894 4:173441891-173441913 ATAAAGTCTGCGGTCTAATAAGG + Intergenic
983997525 4:174203742-174203764 TTAAAATCTCATGTAAAATATGG - Intergenic
986691753 5:10319080-10319102 ATAATGTCACTTGTCAACTGAGG + Intergenic
988322538 5:29717796-29717818 ATAAAGGCTCTGGAAAAATATGG + Intergenic
990438228 5:55816277-55816299 AAAAAGGCTCCTGTCAAATGAGG - Intronic
991008210 5:61853166-61853188 ATAAAGTCTTTTTTTAAAAAAGG + Intergenic
991482241 5:67093268-67093290 AAAAAGACTCTTTTCAAAAAAGG + Intronic
991729794 5:69574488-69574510 ATTAAGTCTGTTGTCTTATATGG - Intronic
991806226 5:70429629-70429651 ATTAAGTCTGTTGTCTTATATGG - Intergenic
991865160 5:71053386-71053408 ATTAAGTCTGTTGTCTTATATGG + Intronic
992918982 5:81492841-81492863 CTAAAGTCCCTTTTAAAATAAGG + Intronic
994008559 5:94872201-94872223 ATAAAGCCTCTCCTCACATATGG - Intronic
994346095 5:98688409-98688431 ATAAAAACTCTTAACAAATAAGG + Intergenic
996449305 5:123600940-123600962 ATTAAGTTTCCTGTCAAATTGGG + Intronic
996592847 5:125167150-125167172 ATAAAATCTCTTACCAAATTAGG + Intergenic
996728219 5:126691598-126691620 ATAAAGTCTTTTGAAAAAAAAGG + Intergenic
1000674973 5:164109931-164109953 ATGAAGCCTCTTGTCTAATCAGG + Intergenic
1000862367 5:166471716-166471738 AGGAAGTATGTTGTCAAATATGG - Intergenic
1003929347 6:10908670-10908692 ATCAAGACTCTTATGAAATATGG + Intronic
1005080696 6:21953740-21953762 ATAAAATCTCTTGGGAAAAAGGG - Intergenic
1006857565 6:37145967-37145989 TTAAAGTGTTTTGTAAAATAGGG - Intergenic
1009859900 6:69314016-69314038 ATTAAGTCACTTGTTAAATAAGG - Intronic
1012767299 6:103384733-103384755 AGAAAGTGTCTTGAAAAATATGG + Intergenic
1013913307 6:115304179-115304201 ATAAAAACTCTTGACAAATTAGG - Intergenic
1014896042 6:126900422-126900444 ATAAAGTCTATTGTCACTAATGG + Intergenic
1015054633 6:128884974-128884996 ATTTACTCTCTTTTCAAATAAGG + Intronic
1015852904 6:137593036-137593058 CTAAAGTCTCATCTGAAATAAGG + Intergenic
1016030934 6:139337247-139337269 ATCAAGTCTCTTGTCAAGGGTGG - Intergenic
1016205996 6:141469318-141469340 ATAAAGTCTCATTTAAAAAATGG - Intergenic
1016218208 6:141629151-141629173 ATAAAGTCTCTTCTCTCATTTGG - Intergenic
1016260648 6:142166018-142166040 ATAAATTTTTTTATCAAATAAGG - Intronic
1016573659 6:145543390-145543412 ACATAGCCTCTTGTCAAAAAAGG + Intronic
1018370882 6:163166842-163166864 AAAAAGTATTTTGTCAGATATGG - Intronic
1020424573 7:8049958-8049980 AAAATGTCTCTTGACAAATATGG + Intronic
1020472085 7:8549212-8549234 CTAGAGTCTCTTATCAAATGTGG + Intronic
1021104256 7:16618480-16618502 TTAAATTCTCTTTTCAAATCAGG - Intronic
1022266909 7:28765804-28765826 ATAAAGTATGTTTCCAAATATGG + Intronic
1022881381 7:34591602-34591624 ATAAAATCTCTTAGCAAATAGGG + Intergenic
1026202599 7:68227407-68227429 ATAAAATCTCTTATGAAAAAGGG - Intergenic
1026220745 7:68394557-68394579 ATAAAGTCTCTTGTAGAAATAGG + Intergenic
1027697426 7:81429607-81429629 ATAAAATCACTTGACATATATGG + Intergenic
1027827679 7:83136860-83136882 TTAAATTATCTTGTAAAATATGG - Intronic
1028676184 7:93464580-93464602 ATAAAGTCTCTTGTCAAATAGGG - Intronic
1028975402 7:96907564-96907586 ATAAAGTATCTTGTAATAAATGG + Intergenic
1030697019 7:112596621-112596643 ATAAACTCACTGGTCACATAAGG + Intergenic
1030791635 7:113737125-113737147 ATAAAGTCTAGAGTCAAATTAGG + Intergenic
1030867555 7:114717954-114717976 AGAAAGTCTCTTATCACCTATGG + Intergenic
1031138468 7:117913156-117913178 ATAAAGTATCTAGAAAAATATGG + Intergenic
1031157856 7:118131726-118131748 ATAAAGTCTATAGTTATATAGGG - Intergenic
1032707776 7:134436357-134436379 ATAAAATCTCTTGGCAAAGTAGG - Intergenic
1032860285 7:135871540-135871562 ATAAAGTCCCTTTACAAATTAGG - Intergenic
1034862864 7:154615023-154615045 TGACCGTCTCTTGTCAAATAGGG - Intronic
1034929039 7:155145914-155145936 ATTAAGTATGTTGTCACATATGG + Intergenic
1035127792 7:156621727-156621749 ATAAAAACTCTTGACAAATTAGG + Intergenic
1036285063 8:7436993-7437015 ATAAAACCTCTTGAAAAATATGG - Intergenic
1036336413 8:7874536-7874558 ATAAAACCTCTTGAAAAATATGG + Intergenic
1040705922 8:50127031-50127053 ATAAAGTCTCCTGGTAAATAAGG + Intronic
1040891100 8:52317188-52317210 GTAAAGACTCTTTTCAAATAAGG - Intronic
1041188460 8:55327732-55327754 CTAAATTCTTCTGTCAAATATGG - Intronic
1041208181 8:55519883-55519905 ATAAAGTCAGTTGACAATTAGGG + Intronic
1041384537 8:57285963-57285985 ACAAAACCTATTGTCAAATAAGG + Intergenic
1044938688 8:97318404-97318426 AAAAACTCTATTTTCAAATAAGG + Intergenic
1045127977 8:99115149-99115171 ATAAAAATTTTTGTCAAATATGG - Intronic
1045138710 8:99254557-99254579 ATTTTGTCTTTTGTCAAATATGG + Intronic
1046005623 8:108479668-108479690 ATAAAGGCTATAGACAAATAAGG - Intronic
1046290890 8:112159405-112159427 ATAATGTGTCTGGTCAGATATGG - Intergenic
1047720735 8:127636708-127636730 ATAAAGTTCCCTATCAAATAGGG + Intergenic
1049951520 9:649112-649134 ATTAAGTCTCCTGGCATATAAGG + Intronic
1050862452 9:10451300-10451322 ATTAATTCTCTAGTGAAATAAGG - Intronic
1051106042 9:13581414-13581436 ATGGAGTATCTTGTCAGATATGG - Intergenic
1051988414 9:23120083-23120105 ATAAATTTTATTGTCCAATATGG + Intergenic
1052371712 9:27672734-27672756 ATAAACTATCTTATAAAATAAGG + Intergenic
1052439067 9:28469721-28469743 ATAAAGTTTCTTCAAAAATAAGG + Intronic
1052717998 9:32141326-32141348 AGAAAGACTCTGGTCAATTATGG + Intergenic
1054937255 9:70701095-70701117 ATAAATTTTCTAGTCAAGTATGG + Intronic
1055094369 9:72395726-72395748 AAAAAGTTGCTTTTCAAATAAGG + Intergenic
1055180310 9:73379235-73379257 ATAAACTCTCATGTGAACTATGG - Intergenic
1057089520 9:92244478-92244500 AGATAGTCTCTTCTCCAATATGG + Intronic
1057464587 9:95301279-95301301 ATAAATTCTTAAGTCAAATAAGG + Intronic
1057518727 9:95743425-95743447 ATAAAGTTTCTTAACAAATGAGG + Intergenic
1057830698 9:98404118-98404140 AGAAAGTATTTTGTAAAATAAGG - Intronic
1058323740 9:103668965-103668987 AAAAAGTCTCTGGTCCAATCTGG - Intergenic
1058570946 9:106342926-106342948 ACAAAGACTCTTTTCACATATGG - Intergenic
1058930414 9:109713512-109713534 ATAAAGTCTCCTTTAAAATAAGG + Intronic
1059466597 9:114472566-114472588 ATACAGTCTATTGTAAAATGAGG - Intronic
1059565181 9:115377247-115377269 ATAAAGTATCATCTCAAATTTGG + Intronic
1059983595 9:119799636-119799658 AAAAAGCCTTTTGTCCAATAGGG + Intergenic
1186575850 X:10764834-10764856 AAAAAGTGTATTGTCCAATATGG - Intronic
1188618000 X:32182286-32182308 ATAAAATCTGGTGTTAAATAAGG - Intronic
1188638651 X:32469352-32469374 ATAAAGGCTCATGACAAAAATGG + Intronic
1189577382 X:42368827-42368849 GCAAAGACTCTTGTCAAACAAGG - Intergenic
1189664140 X:43334591-43334613 ATAAAGTGTCTTCTCATAGAGGG - Intergenic
1191180840 X:57561929-57561951 ATAAATTATCTTGTGCAATATGG - Intergenic
1191908192 X:66118451-66118473 AAAAACTCTATTTTCAAATAAGG + Intergenic
1192258509 X:69487378-69487400 TTAAAGTCTTTTGCCAAAAATGG + Intergenic
1196566722 X:117215150-117215172 ATACAAACTCTTGACAAATAAGG + Intergenic
1197996513 X:132381854-132381876 ATAAATTCTCTTGACCAATGAGG + Intronic
1199128351 X:144153231-144153253 ATAAAGTCTATTAACAAATTAGG - Intergenic
1199393022 X:147303905-147303927 ATAAAGACTCTTATCAAGTTAGG + Intergenic
1199689908 X:150301402-150301424 ATAAAGTCTATTAAAAAATAAGG - Intergenic
1199876938 X:151940029-151940051 ATAAAGTAAATTGTCATATAAGG - Intergenic
1201245212 Y:11996889-11996911 AAAAACTCTTTTTTCAAATAAGG - Intergenic