ID: 1028676212

View in Genome Browser
Species Human (GRCh38)
Location 7:93464870-93464892
Sequence CTACGTCATCTCTACATATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 76}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028676212 Original CRISPR CTACGTCATCTCTACATATT GGG (reversed) Intronic
904393456 1:30201069-30201091 CAACTGCATCTCTACATATTGGG - Intergenic
905751713 1:40470689-40470711 CTACATCATCCCTACAAAGTGGG + Intergenic
920219114 1:204383150-204383172 CTACATCATTTAAACATATTTGG + Intergenic
1064880658 10:20049393-20049415 TTACTTCCTCTCTACCTATTTGG - Intronic
1065447449 10:25817920-25817942 CTGCCTCATTTCTACAGATTGGG + Intergenic
1072060794 10:91808822-91808844 CTACCTAATTTCTAAATATTGGG - Intronic
1079147803 11:17869350-17869372 CTAGGTGTTCTTTACATATTAGG - Intronic
1081006431 11:37749464-37749486 CTAGTTCTTCTCTACATGTTGGG - Intergenic
1087543696 11:99555187-99555209 CTAGGTTATCTCTATATTTTAGG - Intronic
1088526580 11:110762580-110762602 CTCCTTCATCACTACATAGTGGG + Intergenic
1088992596 11:114966970-114966992 CTAGGTGATGTCTACATATATGG + Intergenic
1092579639 12:9824648-9824670 TTACGTCCTCTCTTCCTATTTGG - Intergenic
1093586061 12:20837592-20837614 TTACTTAGTCTCTACATATTTGG + Intronic
1096124532 12:49109941-49109963 GTTCCTCATCTCTACATATTAGG + Intronic
1101710998 12:107266159-107266181 CTACAGTATCTCTAAATATTTGG + Intergenic
1102203791 12:111076363-111076385 CTAGGTCATCTCTACATGGTAGG - Intronic
1111095820 13:83514075-83514097 TTATGTCATCGCTTCATATTTGG - Intergenic
1114793865 14:25689960-25689982 CAACGGCAGCTCTAGATATTTGG - Intergenic
1120033716 14:79671442-79671464 CTTGGGCATCTATACATATTTGG + Intronic
1120165861 14:81198919-81198941 CTAAGTAATTTCTACATCTTGGG + Intronic
1125463263 15:39926299-39926321 CTCCCTTATCTCTCCATATTAGG - Intergenic
1127010732 15:54624639-54624661 CTAACTGATCTTTACATATTTGG - Intronic
1135059129 16:19255925-19255947 CTAGATCATCTCCACATACTGGG + Intronic
1144369584 17:14577313-14577335 CTAGGTCATCTCTGTTTATTCGG - Intergenic
1150853376 17:68727016-68727038 CTACTTCCTCTCTTCCTATTTGG - Intergenic
1153797652 18:8639869-8639891 CTACGTCATCTCTATGAATCTGG - Intergenic
1154396606 18:13996588-13996610 CTATGTCATCTCTGCAACTTTGG - Intergenic
1156991340 18:43411742-43411764 TCACAACATCTCTACATATTTGG - Intergenic
1164263225 19:23587479-23587501 CAATGTCATCTCCACATTTTAGG - Intronic
1165230327 19:34382725-34382747 CTAACTCATCTCTACATGCTGGG - Intronic
926830188 2:16953457-16953479 CTATGTCATTTCTACTTGTTTGG + Intergenic
926836826 2:17032300-17032322 CAAAGTCACCTCTACATTTTCGG + Intergenic
929940033 2:46326617-46326639 ATACTTCATTTGTACATATTTGG + Intronic
930711801 2:54557262-54557284 CCACGTCTTTACTACATATTGGG + Intronic
931311600 2:61086465-61086487 CTGCTGCATCTCTAAATATTGGG - Intronic
938704397 2:133910026-133910048 CTAGAACATCTCTAGATATTTGG + Intergenic
943894459 2:193336607-193336629 ATTTTTCATCTCTACATATTTGG + Intergenic
957823006 3:85402051-85402073 ATACGTTATTTCTACATTTTTGG + Intronic
959316931 3:104821170-104821192 CAAAGTCACCTCTACATTTTTGG - Intergenic
960524986 3:118699456-118699478 ATACTCCATCCCTACATATTTGG - Intergenic
962005777 3:131348217-131348239 ATACCTCATCTTTAGATATTAGG - Intronic
963250703 3:143100517-143100539 CCACAACATCTTTACATATTTGG - Intergenic
965386746 3:168055156-168055178 CAAAGTCATTTCTACATTTTTGG - Intronic
971099820 4:23453016-23453038 ATATGTTATCTCAACATATTAGG - Intergenic
974407914 4:61499466-61499488 TTAAGTCATCTTTACATATATGG - Intronic
977801105 4:101232950-101232972 CTTCTTCATTTCTACATATTAGG + Intronic
978592179 4:110336051-110336073 CTAGGGAATCTTTACATATTAGG - Intergenic
980742563 4:136972011-136972033 CTTCTTCTTCTCCACATATTGGG - Intergenic
982991341 4:162279668-162279690 CTTCTTCAACTCTACATTTTAGG - Intergenic
983155913 4:164348467-164348489 CTACGTCATATCTATGTCTTTGG - Intronic
986144113 5:5060966-5060988 CTACCTCTTCTCTAAATAATAGG - Intergenic
986155414 5:5169911-5169933 CACCTTCATCTCTAAATATTGGG + Intronic
990157257 5:52891799-52891821 TTAGGTCATATCTACATATTGGG + Intronic
992670190 5:79052378-79052400 TTAAGTCTTCTCTACATATCTGG + Intronic
994359256 5:98831622-98831644 CTTAGTCATTTCTACTTATTTGG + Intergenic
997395189 5:133554034-133554056 CTACCTCATCTATACAAATAAGG + Intronic
1003396233 6:5754819-5754841 CAAGGTCATCTCTTCATCTTGGG + Intronic
1004063531 6:12221156-12221178 CTTGATCATCTCTGCATATTCGG + Intergenic
1008347391 6:50444406-50444428 CTATGTCATCCCTACAAAGTGGG - Intergenic
1009591441 6:65676622-65676644 TTAATTCCTCTCTACATATTTGG - Intronic
1009892429 6:69703506-69703528 GTCAGTCATCTCTACAGATTTGG - Intronic
1012641718 6:101625769-101625791 CTCAGTCATCTTTATATATTTGG - Intronic
1013969815 6:116003210-116003232 CTAAGTCATCTCTAAATATGAGG - Intronic
1015220127 6:130794902-130794924 GTACATAATGTCTACATATTTGG + Intergenic
1016806609 6:148218360-148218382 CTCTGTCATCTTTACATGTTAGG - Intergenic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1021790306 7:24197864-24197886 CTACATCGTCTCCAGATATTGGG - Intergenic
1023791127 7:43754696-43754718 CTTCCTCACCTCTACATATCTGG + Intergenic
1024569481 7:50711899-50711921 CTACCTCATCTTTACAGATGAGG + Intronic
1024917498 7:54518160-54518182 TTAATTCATCTTTACATATTTGG + Intergenic
1028676212 7:93464870-93464892 CTACGTCATCTCTACATATTGGG - Intronic
1030863164 7:114662894-114662916 TAAAGTCATCTCTTCATATTAGG - Intronic
1041967586 8:63697915-63697937 CTCAGTCATAACTACATATTAGG + Intergenic
1041988909 8:63960978-63961000 ATAAGACATCTCTACATCTTGGG + Intergenic
1046493956 8:114989184-114989206 TTACTTCTTCTATACATATTTGG - Intergenic
1050175709 9:2867581-2867603 CTATGTCTTCTCTTCATATAAGG + Intergenic
1059359766 9:113732892-113732914 CTAGGTCATGCTTACATATTGGG + Intergenic
1185444849 X:252452-252474 CAAGGTGATCTCTACATGTTTGG + Intergenic
1188289911 X:28374745-28374767 CTCCCTCATCTCTATATATTTGG + Intergenic
1193855365 X:86594599-86594621 CTGTTTAATCTCTACATATTGGG + Intronic
1194005093 X:88481662-88481684 TTATGTCATCTCAAGATATTTGG - Intergenic
1197096060 X:122596736-122596758 GTTCTTCATCTCTAAATATTTGG - Intergenic
1199561273 X:149165404-149165426 TTACTTCCTCTCTTCATATTTGG - Intergenic