ID: 1028677186

View in Genome Browser
Species Human (GRCh38)
Location 7:93478802-93478824
Sequence GTGACTGCCCAGATATTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028677186_1028677190 24 Left 1028677186 7:93478802-93478824 CCTGAAAATATCTGGGCAGTCAC 0: 1
1: 0
2: 2
3: 9
4: 120
Right 1028677190 7:93478849-93478871 TAGATAAACAATGTCTGGCTAGG 0: 1
1: 0
2: 2
3: 25
4: 267
1028677186_1028677191 27 Left 1028677186 7:93478802-93478824 CCTGAAAATATCTGGGCAGTCAC 0: 1
1: 0
2: 2
3: 9
4: 120
Right 1028677191 7:93478852-93478874 ATAAACAATGTCTGGCTAGGAGG 0: 1
1: 0
2: 1
3: 3
4: 112
1028677186_1028677189 19 Left 1028677186 7:93478802-93478824 CCTGAAAATATCTGGGCAGTCAC 0: 1
1: 0
2: 2
3: 9
4: 120
Right 1028677189 7:93478844-93478866 GCTGGTAGATAAACAATGTCTGG No data
1028677186_1028677187 1 Left 1028677186 7:93478802-93478824 CCTGAAAATATCTGGGCAGTCAC 0: 1
1: 0
2: 2
3: 9
4: 120
Right 1028677187 7:93478826-93478848 TACAGCCATTCTAGAGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028677186 Original CRISPR GTGACTGCCCAGATATTTTC AGG (reversed) Intronic
900310971 1:2032949-2032971 GTTTCTGCCCACATATTTACAGG + Intergenic
902369389 1:15996144-15996166 ATGGCTGCCCAGATATCTGCTGG + Intergenic
906630462 1:47362977-47362999 TACACTGCCCAGATATTTACTGG - Intronic
907066139 1:51485075-51485097 TTGTCTGCCCATCTATTTTCTGG - Intronic
909187713 1:72510242-72510264 GTATTTGGCCAGATATTTTCTGG - Intergenic
910285437 1:85548950-85548972 TTCGATGCCCAGATATTTTCAGG - Intronic
912739443 1:112180175-112180197 CTGTCTCCCCAGGTATTTTCAGG - Intergenic
918332630 1:183473647-183473669 GTCACTCCCCAGTTAATTTCAGG - Intronic
920820703 1:209378101-209378123 TTCACTGCCCAGTTATGTTCTGG - Intergenic
923734287 1:236588329-236588351 GTGAGAGCCCAGATATTGACGGG + Intronic
1065095910 10:22280411-22280433 GTGTCTTCCTAGATATCTTCAGG + Intergenic
1066046091 10:31596804-31596826 GAGAATACCCAGATATTTTTAGG + Intergenic
1069568727 10:69481106-69481128 GTGTCTGTCCAGATAGTCTCTGG + Intronic
1070191505 10:74115832-74115854 GTGACTGCCAAGGTATATGCAGG - Intronic
1070228373 10:74536347-74536369 GTGTCTAACCAAATATTTTCAGG - Intronic
1070707018 10:78647174-78647196 GTGCCTGCCCAGGTGTGTTCAGG + Intergenic
1071778944 10:88820741-88820763 GAGAATGTCTAGATATTTTCTGG - Intergenic
1072132143 10:92504785-92504807 GTGACTCACCGGACATTTTCTGG + Exonic
1072977017 10:100067674-100067696 GAGAATGCCTAGTTATTTTCAGG + Intronic
1073398834 10:103240494-103240516 GTGACTACCCAGATACAGTCAGG + Intergenic
1073734466 10:106329997-106330019 CTGACTGCCCAGAAATTTACTGG + Intergenic
1079740566 11:24054386-24054408 GTGACTACTCATATTTTTTCTGG + Intergenic
1080011506 11:27464254-27464276 TTGGCAGACCAGATATTTTCAGG - Intronic
1080421648 11:32116322-32116344 GGGACTACCCAGCTAATTTCTGG - Intergenic
1084759471 11:71260144-71260166 GACACTGCCAACATATTTTCAGG - Intergenic
1088871599 11:113894775-113894797 GTGAACTCCCAGATATTTCCTGG - Intergenic
1089526461 11:119100511-119100533 GTGTCTTCCCAGATCCTTTCTGG - Intronic
1089806700 11:121097143-121097165 GAGAATGCCTAGATATTTTGAGG - Intergenic
1094774172 12:33703683-33703705 GTGGTTGCCCAGATATGTGCAGG + Intergenic
1096346510 12:50851868-50851890 TAGACTGCCCCGATCTTTTCTGG - Intronic
1096519471 12:52176093-52176115 AAGACTGGCCAGACATTTTCTGG + Intronic
1098063802 12:66590680-66590702 AGGACTGCACAGACATTTTCTGG + Intronic
1101703003 12:107193191-107193213 GTGACTTATCAGATTTTTTCTGG + Intergenic
1109169785 13:59081207-59081229 GTCACAGCCCAATTATTTTCAGG - Intergenic
1111373996 13:87354467-87354489 TTGACTGTCCAAATATTTTCTGG + Intergenic
1112760151 13:102686449-102686471 GTGACTGCCCAGATGTTTCCAGG - Intronic
1117236204 14:53779372-53779394 GTGACTGCCAAGAGATTTCTGGG + Intergenic
1118977383 14:70689352-70689374 GTCACTGCCCAAATATTTTGTGG - Intergenic
1121006155 14:90491867-90491889 GGGACTGGCTAGATATTCTCTGG - Intergenic
1125382045 15:39096411-39096433 CTGAGTGCCCAGAAATTTGCTGG - Intergenic
1125524276 15:40365344-40365366 CTGTCTGCCCAGATTTGTTCTGG - Intronic
1128826654 15:70723957-70723979 CTGACTCCCCAGATTTTGTCAGG + Intronic
1132779182 16:1613764-1613786 GTGACAGCCCAGTTATGTCCGGG - Intronic
1134325770 16:13206256-13206278 CTGCCTGCCCAGAGTTTTTCGGG - Intronic
1135743185 16:24994422-24994444 GTCACTGAACAAATATTTTCGGG + Intronic
1140838313 16:78815876-78815898 GTGACTTCCAAGATATATACAGG + Intronic
1142033956 16:87852363-87852385 GTGACTGGCCAGGTAGTTCCGGG - Intronic
1148312917 17:46664054-46664076 CTGACTGCCCAGATGGTATCAGG + Intronic
1148735735 17:49863969-49863991 GTTTCTTCCCGGATATTTTCAGG + Intergenic
1149417299 17:56472782-56472804 ATGCCTTCCCTGATATTTTCAGG - Intronic
1151142865 17:72011836-72011858 GCAACTGCCCAGTTATTTTAAGG + Intergenic
1153014231 18:568892-568914 ATGGCTGCTCAGATATTTCCAGG - Intergenic
1153504412 18:5780871-5780893 GTAACTGCCAAGATATTAGCAGG + Intergenic
1157191729 18:45587651-45587673 GTGACTTCCAAGATCTCTTCTGG - Intronic
1157942906 18:51948645-51948667 GTGACTGCCAAGATATCTCTGGG - Intergenic
1159236942 18:65687604-65687626 ATGTCTGCCCAGGTTTTTTCTGG + Intergenic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1162173851 19:8814584-8814606 GTGCCTTCTCAGGTATTTTCTGG - Intronic
1164840837 19:31391039-31391061 CTGACTGCCATGATATTTGCTGG + Intergenic
1165843817 19:38805469-38805491 GTGACAGCCCAGAAATGGTCAGG - Intronic
925859273 2:8159416-8159438 GTGGCTGCGCCGATGTTTTCAGG - Intergenic
928917739 2:36491057-36491079 ATGACTGCCTAGCTGTTTTCAGG + Intronic
930574591 2:53130694-53130716 GTGACTAACCATTTATTTTCAGG - Intergenic
932695968 2:73956814-73956836 GTGACTTCCCAGATATAGTAGGG + Intronic
934575959 2:95401800-95401822 GTGAGTGTCCAGAGATGTTCAGG - Intergenic
934795522 2:97095753-97095775 GTGAGTGTCCAGAGATGTTCAGG + Intergenic
937875280 2:126820425-126820447 GTGACTTCCAGGATACTTTCAGG - Intergenic
937882434 2:126878432-126878454 GTGACTGCTCAGCTGCTTTCTGG - Intergenic
938560158 2:132465216-132465238 GCGACTGCCCAGATCTGATCAGG - Intronic
938840902 2:135162114-135162136 GTGACTTCCCACACATTTTTTGG - Intronic
939329329 2:140737306-140737328 GTGACTGCTTAGATATGTTGAGG + Intronic
939628475 2:144507787-144507809 GTAACTGCGCATATTTTTTCAGG - Intronic
946998172 2:225420219-225420241 ATGAATTTCCAGATATTTTCAGG + Intronic
1169039003 20:2477389-2477411 CTGACTTCCCAGATTTTTACTGG + Intronic
1170084226 20:12511019-12511041 GTGTCTGTGAAGATATTTTCTGG - Intergenic
1175468120 20:59206833-59206855 GTGACTTTCCAGATTTTTCCAGG + Intronic
1175629211 20:60519086-60519108 GCGTCTCCCCAGATATTATCAGG + Intergenic
1182450403 22:30416705-30416727 GTGACTGGACAGATATTTCTTGG + Intronic
1183225804 22:36549082-36549104 ATGCCTGCCCAGAGGTTTTCAGG + Intergenic
1185155736 22:49192399-49192421 GTGACTGCCCAGCTGCTTCCGGG + Intergenic
949447894 3:4154804-4154826 GTGGTTGCCCAGATATTGGCTGG - Intronic
950307573 3:11928289-11928311 GTGAATGCACACATATTTTGAGG - Intergenic
950523881 3:13512421-13512443 GTGACTTCTCTGCTATTTTCTGG + Intergenic
951156813 3:19364521-19364543 GTTACTGGCCAGCTATTTTTTGG + Intronic
955315302 3:57933610-57933632 CTGGTTGCCCAGATATTCTCTGG - Intergenic
959922852 3:111888298-111888320 GTGATTGCCCAGAGGTTCTCTGG + Intronic
960313904 3:116152165-116152187 GTAAATGCCAAGATATTTTGGGG + Intronic
962437370 3:135379470-135379492 TAGATTGCACAGATATTTTCTGG - Intergenic
964187166 3:153960269-153960291 GAGACTCCCAAGCTATTTTCAGG + Intergenic
964893217 3:161561664-161561686 GTAACAGCTCTGATATTTTCTGG + Intergenic
965727074 3:171729429-171729451 GTGATTGCCAAGTAATTTTCAGG - Intronic
966609214 3:181851482-181851504 GTGACTTCCCAGAAAATCTCAGG - Intergenic
968057213 3:195701484-195701506 GTGACTGCCCAGGTGTCTGCTGG + Intergenic
972999039 4:44922387-44922409 GAGTCTTCACAGATATTTTCTGG - Intergenic
974771177 4:66415660-66415682 TTGACTGCCCAGATTTTCTCTGG + Intergenic
977920331 4:102636192-102636214 GTGCCTGCCCAGATGTTGTGAGG - Intronic
981702357 4:147620426-147620448 GTAACTTCTCAGATCTTTTCTGG - Intronic
982853714 4:160353807-160353829 GAAAGTGCCCAGATATCTTCCGG + Intergenic
984701553 4:182821878-182821900 GCGCCTGGCCATATATTTTCAGG + Intergenic
990628517 5:57641490-57641512 ATGTGTGCCCAGATACTTTCAGG + Intergenic
991378491 5:65991987-65992009 GGGAATGCGAAGATATTTTCAGG - Intronic
992602236 5:78414170-78414192 GAGACTTCCCAGATATTTTATGG + Intronic
997764218 5:136483729-136483751 GAGAAGGCCCAGATATTTTCTGG - Intergenic
1000692689 5:164342734-164342756 GTGACTGCCCTAATATTCACTGG - Intergenic
1002392735 5:178928505-178928527 ATGACTGCCCTGATGGTTTCTGG - Intronic
1004195028 6:13495964-13495986 GTTACTGCCTAGATACTTCCAGG - Intergenic
1005907471 6:30276783-30276805 GGGAATGTCCAGATATTTTCAGG + Intergenic
1006899808 6:37492786-37492808 GTGCCTGCCCAGATGGTCTCTGG + Intronic
1007449317 6:41931095-41931117 GTGACTGCCCAGGCATGCTCAGG + Intronic
1008655792 6:53612376-53612398 GTATCTGCTTAGATATTTTCAGG + Intronic
1013633371 6:112006490-112006512 GGGACTACCCAGATATTTTGAGG - Intergenic
1015695388 6:135974644-135974666 GTAACTGCCTAGATATAATCAGG - Intronic
1020203079 7:6095320-6095342 GGGTCTGCTCAGATATTTCCAGG - Intergenic
1027633314 7:80636221-80636243 TTGAGTGCCTAGAAATTTTCAGG + Intronic
1028677186 7:93478802-93478824 GTGACTGCCCAGATATTTTCAGG - Intronic
1032616042 7:133472054-133472076 GAGAATGCCCACATATATTCAGG + Intronic
1033710964 7:143943496-143943518 ATAAATGCACAGATATTTTCAGG + Intergenic
1033873534 7:145786461-145786483 GTGACTGGAGAGATTTTTTCAGG - Intergenic
1035659357 8:1335135-1335157 GTCACTGCCCAGATAATTTCTGG + Intergenic
1038465887 8:27762410-27762432 GTTACTTACCAGATATCTTCAGG + Exonic
1041868577 8:62606284-62606306 GTGCCTGAACAGATATTTTCAGG - Intronic
1048408888 8:134151087-134151109 ATGAATGCCGAGACATTTTCAGG + Intergenic
1048417122 8:134239832-134239854 GTTACTGCTCTGGTATTTTCTGG + Intergenic
1050191726 9:3033443-3033465 ATGATTGCCCCGATATTTTATGG + Intergenic
1053385933 9:37688556-37688578 GCTACTTCCCAGATATTTTTGGG - Intronic
1056872476 9:90295378-90295400 TTGAATGCCCACCTATTTTCTGG - Intergenic
1057892207 9:98877729-98877751 GTGACTGCACAGCTGTTTACAGG - Intergenic
1187185360 X:16979501-16979523 CTGACTGCCTAGACTTTTTCTGG - Intronic
1190528295 X:51349955-51349977 GTGTCTGACCAGATGTGTTCAGG + Intergenic
1195405000 X:104503107-104503129 GTGGCTGCACAGATATTTAGCGG + Intergenic
1196382547 X:115107809-115107831 GGAAATGCCCAGATATATTCTGG - Intergenic
1201897453 Y:19007321-19007343 ATGCCTGCACAGATTTTTTCGGG + Intergenic