ID: 1028689294

View in Genome Browser
Species Human (GRCh38)
Location 7:93633608-93633630
Sequence TTAAGTGGCAGCTGCTCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028689294 Original CRISPR TTAAGTGGCAGCTGCTCAAA AGG (reversed) Intronic
900482835 1:2907666-2907688 TTAAATGCCAGATGCTCAGAGGG + Intergenic
902303863 1:15522591-15522613 TAAAGTCCCAGCTGCTCTAAAGG + Intronic
904635537 1:31878038-31878060 CTGAGTGGCTGCTGCTCCAAGGG + Intergenic
905271361 1:36789795-36789817 TTAAGTTCCAGCTGCCCACAGGG + Intergenic
905875896 1:41431964-41431986 ATAAGTGTCCGCTGGTCAAATGG + Intergenic
906618999 1:47258746-47258768 TGTAGTGCCAGCTACTCAAAAGG + Intronic
906793753 1:48680585-48680607 TTCAGTGGCACATGCTGAAAAGG + Intronic
907736182 1:57114864-57114886 TTAAGTGGCAGAGCCTGAAATGG - Intronic
909385116 1:75046059-75046081 TATAGTCTCAGCTGCTCAAAAGG + Intergenic
909756504 1:79232109-79232131 TAAGGTGGCAGCTGGTCAAAGGG - Intergenic
913122137 1:115752167-115752189 TTAAATGTCAGTTCCTCAAAAGG + Intronic
917916357 1:179706299-179706321 TTCAGCAGCAGCTGCTAAAACGG + Intergenic
919186289 1:194155256-194155278 TTAAGAAACAGCTTCTCAAAGGG - Intergenic
919493659 1:198237179-198237201 TTAAGTGTCACCTTCTCAGAAGG - Intronic
920217574 1:204372047-204372069 TTAACTGGCAGCTTCTCGAATGG + Intronic
920983028 1:210856121-210856143 TTAGATGGCAGCTGCCAAAAGGG - Intronic
921015402 1:211185880-211185902 TGAAATGGCAGGTGTTCAAAGGG - Intergenic
921395028 1:214659637-214659659 TTAAATGGCAGCTGCTGGTATGG - Intronic
921817194 1:219577242-219577264 ATTAGTGGCAGCTGCTCCAGGGG + Intergenic
1063943969 10:11159146-11159168 TTATGTGGCAGTGACTCAAAAGG + Intronic
1065937943 10:30537781-30537803 ATAAGTGGCAGCTGCCAGAACGG - Intergenic
1066957494 10:42186917-42186939 TTCACTGGCAGCTGGTTAAATGG - Intergenic
1068197424 10:53735280-53735302 TTATGTCACAGCAGCTCAAATGG - Intergenic
1068667039 10:59687836-59687858 TGTAGTCTCAGCTGCTCAAAAGG + Intronic
1069529021 10:69201654-69201676 TGAAGTCCCAGCTGCTCAAGAGG - Intronic
1073717341 10:106122120-106122142 TTGATTGTCAGCTGCACAAAGGG + Intergenic
1073804311 10:107079895-107079917 TTAGGTGGGAGCTGCTCATGAGG - Intronic
1073870279 10:107855178-107855200 CTAGGTGGCAGCTGCTCTAATGG + Intergenic
1074294276 10:112169059-112169081 TTTACTGTCAGCTGCTCAAACGG - Intronic
1075055960 10:119218518-119218540 TTAAGTGGCTGATGCAGAAATGG + Intronic
1077721371 11:4632885-4632907 ATAAGTGGCAGTTGATCAATGGG + Intergenic
1079523242 11:21353991-21354013 TTAAGTTTCAGCTGCTTCAAAGG - Intronic
1082181167 11:49121514-49121536 TGAAGTCGCAGCTACTCAAGAGG - Intergenic
1083051763 11:59783668-59783690 TTATGTGGCAAATGCACAAAAGG + Intronic
1086216607 11:84390302-84390324 TTAAATGTCAACTGCACAAAAGG + Intronic
1086684323 11:89713332-89713354 TGAAGTCGCAGCTACTCAAGAGG + Intronic
1086688433 11:89760487-89760509 TTTAATTCCAGCTGCTCAAAAGG + Intergenic
1086717427 11:90079457-90079479 TTTAATTCCAGCTGCTCAAAAGG - Intergenic
1088385527 11:109250270-109250292 TTAAGTGGCAGCTCTTCCCAAGG + Intergenic
1089852438 11:121511713-121511735 TTGAATGTCTGCTGCTCAAATGG + Intronic
1090699749 11:129282876-129282898 TTAAGTGGGAGATATTCAAATGG - Intergenic
1091482515 12:848289-848311 TTAAATGTCAGATGCTTAAATGG + Intronic
1093661817 12:21766187-21766209 TCACGTGGCAGATGATCAAAGGG + Exonic
1093955843 12:25217770-25217792 TGAAGTCCCAGCTACTCAAAAGG + Intronic
1094335238 12:29343048-29343070 TTAAGTTGCTTCTTCTCAAAGGG - Intronic
1094459819 12:30683584-30683606 TTAACTAGCAGCTGCTCTATTGG - Intronic
1098358080 12:69629794-69629816 TCAAATGGCAGCTCCTCAGAAGG + Intergenic
1098731906 12:74046361-74046383 TGACGTTGCAGCTGCTAAAAGGG + Intergenic
1099392720 12:82100403-82100425 TTCAGTGGCAGCTTCTGAAAGGG - Intergenic
1100327662 12:93554394-93554416 TTAACTTGGAGCTACTCAAAGGG - Intergenic
1102761862 12:115394546-115394568 TTAAATCACTGCTGCTCAAAAGG - Intergenic
1103511160 12:121475470-121475492 TTAAGTCCCAGCTACTCAAGAGG + Intronic
1104463428 12:128972151-128972173 GGAAGTGGCAGCTGCTCTAATGG + Intronic
1105266607 13:18824458-18824480 CAAACTGGCAGCTCCTCAAAAGG + Intergenic
1107440311 13:40420916-40420938 TTATCTGGCAGCTGCCTAAATGG - Intergenic
1112660893 13:101506514-101506536 TGAAGTAGCAGGTGCACAAATGG + Intronic
1113570394 13:111350127-111350149 TGTAGTGGCAGCTACTCAGAAGG - Intergenic
1116253921 14:42525198-42525220 TTGGGTGGCAGCTGTTCATAGGG - Intergenic
1116489544 14:45490000-45490022 ATAAGTGGGAGCTGATCACATGG + Intergenic
1116891935 14:50277117-50277139 TTAAGTGACAGGATCTCAAAGGG + Intronic
1117676605 14:58161465-58161487 TGACATAGCAGCTGCTCAAAAGG + Intronic
1118128655 14:62937703-62937725 TTTAGGGGCAGCTGTTCACAAGG + Intronic
1118529247 14:66684167-66684189 TTCAGTATCAGCAGCTCAAATGG - Intronic
1119582879 14:75803454-75803476 TGAAGTGGCCGCTGCTCACATGG - Intronic
1119907406 14:78318335-78318357 TTAAGTGGAAACTGCTCTGATGG + Intronic
1122492332 14:102126976-102126998 TTTACTGGCTGCTTCTCAAAAGG + Intronic
1202935605 14_KI270725v1_random:84863-84885 TTCACTGGCAGCTGATGAAATGG + Intergenic
1123477573 15:20600896-20600918 ATAAGTGGGAGCTGACCAAAGGG - Intergenic
1123640443 15:22399486-22399508 ATAAGTGGGAGCTGACCAAAGGG + Intergenic
1124145482 15:27121440-27121462 TTAGGTGCCATCTGCTCAAAGGG - Intronic
1126169004 15:45678828-45678850 TTAAATTGCTGCTCCTCAAATGG + Intronic
1127351836 15:58160913-58160935 ATAAGTGTCATCAGCTCAAAGGG + Intronic
1127815373 15:62604204-62604226 ATATGAGGGAGCTGCTCAAAAGG + Intronic
1128087582 15:64896618-64896640 TAAAGTTTCAGCCGCTCAAAGGG - Intronic
1128271638 15:66315699-66315721 ATAAGGGGCAGCAGCTGAAAGGG - Intronic
1128723181 15:69968077-69968099 CTAAGTGGCAGGTGTTCAACAGG + Intergenic
1128732842 15:70032863-70032885 ATAAGGGGCAGCAGCCCAAAGGG + Intergenic
1133762105 16:8807398-8807420 TCAGGTGGCAGCTGCTCAGGTGG - Intronic
1136996241 16:35191466-35191488 TGTAGTTGCAGCTACTCAAAGGG - Intergenic
1139378564 16:66515978-66516000 TCCAGTGGCAGCTTCTCACATGG + Intronic
1141033770 16:80611116-80611138 TCAAATGTCACCTGCTCAAAGGG + Intronic
1142156965 16:88537043-88537065 GTGAGTGACAGGTGCTCAAAGGG + Intergenic
1143273770 17:5694747-5694769 TTAAGTGGCAGCTCCGCAAAAGG + Intergenic
1145912983 17:28552950-28552972 TCAAATGTCATCTGCTCAAAGGG + Intronic
1147056341 17:37838274-37838296 AAAAGTGGCAGGTCCTCAAAAGG - Intergenic
1147370381 17:39988637-39988659 TCAAGTGGCAGTTCCTCAAAAGG - Intronic
1148548397 17:48534006-48534028 TGAAGTCCCAGCTGCTCAGAAGG + Intergenic
1150665921 17:67138205-67138227 TTAAATGACATCTGCTAAAATGG - Intronic
1150952503 17:69819540-69819562 TTAAGTAGCAGCCGATAAAAAGG - Intergenic
1153093379 18:1373443-1373465 GTAAATGTCAGCTCCTCAAAAGG - Intergenic
1153571175 18:6475147-6475169 TTCAGTGGCAGCTCCTCTACAGG - Intergenic
1154421805 18:14237013-14237035 CAAACTGGCAGCTCCTCAAAAGG - Intergenic
1158238181 18:55343705-55343727 TTAAGTTGCAGCTGCTGCATAGG - Intronic
1158315425 18:56207184-56207206 TTAAGTGACAACTCATCAAATGG + Intergenic
1159692178 18:71502946-71502968 TTAAGGGGCAGAAGCTGAAACGG + Intergenic
1162006572 19:7784231-7784253 TTTAGGGACAGGTGCTCAAAGGG - Intergenic
1164443376 19:28297261-28297283 TTAAGTGGCAGCTGAACATTGGG + Intergenic
1164490041 19:28701844-28701866 TGTAGTCTCAGCTGCTCAAAAGG + Intergenic
1165931926 19:39364862-39364884 TTGAGTGGCAGATGCTGAAGGGG + Intronic
927746276 2:25624420-25624442 TTTAGTAGAAGCTGCTCACAGGG + Intronic
928816638 2:35303426-35303448 TTAGTTGGCAGAAGCTCAAAAGG + Intergenic
929300225 2:40295588-40295610 TTATGTGCCAGATGCTAAAAGGG + Intronic
931350430 2:61482909-61482931 TTAAGTGCCAGCTGGGCACAGGG - Intronic
934466034 2:94263904-94263926 TTCACTGGCAGCTGATTAAATGG + Intergenic
934496327 2:94804104-94804126 CAAACTGGCAGCTCCTCAAAAGG + Intergenic
935154262 2:100468934-100468956 TTAAGTGGGAGTTGCTCAGAAGG - Intergenic
937271681 2:120656870-120656892 TAAAGTGGCAGCTGCTTTCATGG + Intergenic
937672892 2:124557770-124557792 TCAAGTGTCACCTTCTCAAAGGG - Intronic
938865213 2:135411704-135411726 ATAAGTGGGAGCTGATCAATGGG + Intronic
939794146 2:146620430-146620452 TAAAGTGGCATTTGGTCAAATGG - Intergenic
940076068 2:149743551-149743573 TTTATTGGCAGCTACTCAGAAGG - Intergenic
941183234 2:162286661-162286683 GAAAATGGCAGATGCTCAAATGG + Intronic
941691871 2:168508642-168508664 CTAAGTGGCAGCTGAACAATGGG + Intronic
941715890 2:168762993-168763015 TGCAGTTCCAGCTGCTCAAAAGG - Intronic
942359730 2:175159195-175159217 TATAGTTCCAGCTGCTCAAAAGG + Intronic
942423684 2:175836412-175836434 TTAAATGGCACATCCTCAAAAGG + Intergenic
942957801 2:181794552-181794574 TTAAGTGGGAGCTGTGCATAGGG + Intergenic
944451461 2:199847645-199847667 ATTAGTGGCAGCAGCTCAAATGG - Intronic
944860707 2:203813376-203813398 GCAACTGGCAGCTCCTCAAAAGG - Intergenic
945586027 2:211664099-211664121 TGAAGTGACAGATCCTCAAAAGG - Intronic
946237069 2:218330560-218330582 GCAAGTGGCAGCTGCCCCAAGGG - Intronic
948671022 2:239569008-239569030 ATAAGTGGCAACAGCTCTAAAGG - Intergenic
1169229309 20:3876731-3876753 TGAAGAGGCAGCTGCTATAATGG - Intergenic
1172970574 20:38870467-38870489 TTAAGTGTCACCTCCTCAGAGGG - Intronic
1173009558 20:39169474-39169496 TTAACTGACAGATGCTCACATGG - Intergenic
1173668365 20:44779140-44779162 TTGAGGGGCAGCTGGTCACATGG - Intronic
1174520871 20:51129528-51129550 TTCAGAGGCATCTGCTCAACGGG - Intergenic
1175196516 20:57247446-57247468 TTAAATGGCTGCTGAGCAAACGG - Intronic
1176851677 21:13922947-13922969 CAAACTGGCAGCTCCTCAAAAGG + Intergenic
1178708890 21:34896845-34896867 TTGAGTGGCAGCAGCAGAAATGG + Intronic
1180279953 22:10684539-10684561 TTCACTGGCAGCTGATTAAATGG + Intergenic
1180587169 22:16903072-16903094 TTCACTGGCAGCTGATTAAATGG + Intergenic
1180732901 22:17995296-17995318 TATAGTCGCAGCTGCTCAGAAGG - Intronic
1180788959 22:18563462-18563484 TTTAGTTCCAGCTACTCAAAAGG - Intergenic
1181232777 22:21431858-21431880 TTTAGTTCCAGCTACTCAAAAGG + Intronic
1181245874 22:21502998-21503020 TTTAGTTCCAGCTACTCAAAAGG - Intergenic
1181907069 22:26206746-26206768 TTATGTGACAGCAACTCAAATGG - Intronic
1181932522 22:26413969-26413991 TTTAGTGCCAGCTGTTCAAGAGG - Intergenic
949110117 3:250086-250108 TGTAGTGCCAGCTGCTCAAGAGG - Intronic
950360730 3:12447801-12447823 TTCAGTAGGAGCTGCTCAAGCGG + Intergenic
952690824 3:36203267-36203289 TTAATTAGCAGCTTCTCAACTGG - Intergenic
953231407 3:41068301-41068323 GAAAGTGGCATCTGCTTAAAAGG - Intergenic
953471751 3:43173279-43173301 TTAAGAGGCAGCATCCCAAAAGG - Intergenic
954264313 3:49461093-49461115 TTAAGTGACAGCTGCTGGGAGGG + Intergenic
954326212 3:49865632-49865654 TCATGTGGCAGCTGCTCCACAGG - Intronic
957262798 3:77922440-77922462 TTCAGAGCCAGCTTCTCAAAAGG + Intergenic
957360816 3:79154973-79154995 TTCTGTGACAGCTGCTCCAAAGG + Intronic
957948262 3:87092186-87092208 TTAGGTGGCAGCTTCTCAATTGG - Intergenic
961406713 3:126684911-126684933 TTAAGTGTCAGGTGCCCAGAAGG + Intergenic
965771836 3:172189690-172189712 TTTGGTCCCAGCTGCTCAAAAGG + Intronic
966225440 3:177592576-177592598 CTAAATTACAGCTGCTCAAAGGG + Intergenic
966588580 3:181654117-181654139 TTAGGTGGCATCTGTTCAGAAGG - Intergenic
967378811 3:188834831-188834853 TAAATTGGCAGCTGCTGACATGG - Intronic
968822730 4:2867975-2867997 TGCAGAAGCAGCTGCTCAAAAGG - Intronic
975333456 4:73147277-73147299 TTTAATGGAAGCTGCTCAAGAGG - Exonic
975405472 4:73983281-73983303 TTAAGTGTCAGTTCCTCAGAGGG + Intergenic
976838820 4:89407367-89407389 TTTTGTTGCAGCAGCTCAAATGG + Intergenic
977925083 4:102691625-102691647 TATAGTGCCAGCTGCTCAGAAGG - Intronic
981865070 4:149407527-149407549 TTAAGTGGGAGCTAATCAATGGG - Intergenic
982605165 4:157506963-157506985 TTGAGGAGCAGCTGCTTAAATGG + Intergenic
983618705 4:169736520-169736542 TTAGATGGCAGCTACTCATACGG - Intronic
984898031 4:184559332-184559354 TGCAGTGGCAGCAGCTCATATGG + Intergenic
989626001 5:43430052-43430074 TTGAGTGGCAGCTGGTCAGTGGG - Intergenic
991928824 5:71731565-71731587 TGCAGTCCCAGCTGCTCAAAAGG + Intergenic
992117476 5:73554172-73554194 TTTGGTGGCAGGTGCTCTAAGGG + Intronic
992445298 5:76827914-76827936 TTATCTGGCAGTTCCTCAAATGG - Intronic
994667774 5:102727588-102727610 TCCAGTGCCAGCTACTCAAAAGG + Intergenic
996689149 5:126319348-126319370 TTAAGTGCTAGCTGCTGGAAAGG - Intergenic
998877848 5:146618622-146618644 TATAGGGGCAGCTGCTGAAAGGG - Intronic
1000155313 5:158545413-158545435 GTAAGTCCCAGCTACTCAAAGGG - Intergenic
1001238028 5:170046112-170046134 TTCGGTGACAGCTCCTCAAAGGG + Intronic
1002516336 5:179761720-179761742 TTAAGTGGCAGATGATAAGAGGG + Intronic
1003240317 6:4339743-4339765 TTAAGTGGCATGTGTTCACAGGG + Intergenic
1003347238 6:5281939-5281961 TTAAGTGACAGGTGGTAAAATGG + Intronic
1004631409 6:17425309-17425331 TCAAGTGGCAACTGCCCAACAGG - Intronic
1007907974 6:45483151-45483173 TTAATTTCCAGCGGCTCAAAGGG + Intronic
1009905042 6:69859860-69859882 TTATGTTATAGCTGCTCAAATGG - Intergenic
1011163565 6:84420137-84420159 TCAAGTGGCAGATCCTCAAGAGG + Intergenic
1011741474 6:90364780-90364802 TTAAGTGCCTGCTGCTTCAAAGG - Intergenic
1014237490 6:118975952-118975974 AGAATTGGCAGCTGCTAAAATGG - Exonic
1014328751 6:120033017-120033039 CAAATTAGCAGCTGCTCAAATGG - Intergenic
1017376720 6:153778596-153778618 TCAGGTGGCAGCTGATAAAAAGG + Intergenic
1017506687 6:155074945-155074967 TGGAGGGGCAGCTGGTCAAATGG + Intronic
1018090577 6:160343980-160344002 TTAAGTGGCATCTGGGCAAGTGG + Intergenic
1018559423 6:165086002-165086024 TTAAGTGGGAGCTGAACAATGGG + Intergenic
1019897155 7:3991421-3991443 TTACGTCGCAGGTGCGCAAAGGG - Intronic
1019926211 7:4194708-4194730 TTAAGTGGCAGCTGATGAGATGG + Intronic
1021377284 7:19923686-19923708 TTAAGTATCAGCTCCTCAAAAGG - Intergenic
1022740265 7:33113597-33113619 TTACCTGGTAGCTGCTGAAACGG + Intergenic
1028595394 7:92543117-92543139 TGTAGTCCCAGCTGCTCAAAAGG + Intergenic
1028689294 7:93633608-93633630 TTAAGTGGCAGCTGCTCAAAAGG - Intronic
1034860289 7:154589142-154589164 TTAGGAGGCACCTGCTCAAATGG - Intronic
1036518072 8:9463980-9464002 TTATGTGGCAGTTTATCAAATGG + Intergenic
1037214701 8:16434887-16434909 GTAAGTGGGAGCTGCACAATGGG + Intronic
1038164061 8:25067755-25067777 TTCAGGGGCAGCTGCTGAGATGG - Intergenic
1039404925 8:37304262-37304284 ATCAGTGGAAGCTGCTCAGAAGG + Intergenic
1039597128 8:38800037-38800059 TTTAGTCCCAGCTGCTCAGAAGG + Intronic
1040100558 8:43498407-43498429 CAAACTGGCAGCTCCTCAAAAGG - Intergenic
1041897974 8:62948036-62948058 CTAAGCGGCAGTTGCTCATATGG - Intronic
1046728633 8:117701181-117701203 TTAGGTGGCACCTGCTCTACCGG + Intergenic
1048338846 8:133523496-133523518 TAAAGTGGCAGCTACTTCAAAGG + Intronic
1049879170 8:145050775-145050797 TTGAGGGCCAGCTGCTCATAAGG - Intergenic
1053660814 9:40276344-40276366 CAAACTGGCAGCTCCTCAAAAGG - Intronic
1053696091 9:40640670-40640692 TTCACTGGCAGCTGATTAAATGG + Intergenic
1053911192 9:42905690-42905712 CAAACTGGCAGCTCCTCAAAAGG - Intergenic
1054307338 9:63439888-63439910 TTCACTGGCAGCTGATTAAATGG + Intergenic
1054372936 9:64422560-64422582 CAAACTGGCAGCTCCTCAAAAGG - Intergenic
1054406069 9:64763898-64763920 TTCACTGGCAGCTGATTAAATGG + Intergenic
1054439695 9:65249371-65249393 TTCACTGGCAGCTGATTAAATGG + Intergenic
1054490712 9:65772568-65772590 TTCACTGGCAGCTGATTAAATGG - Intergenic
1054523796 9:66099940-66099962 CAAACTGGCAGCTCCTCAAAAGG + Intergenic
1054680566 9:67912337-67912359 CAAACTGGCAGCTCCTCAAAAGG - Intergenic
1054829279 9:69605637-69605659 TTAATAGTCAGCAGCTCAAAGGG - Intronic
1056225847 9:84494269-84494291 TTTAGTCCCAGCTGCTCAAGAGG + Intergenic
1058482849 9:105414673-105414695 TGCAGTGCCAGCTACTCAAAAGG + Intronic
1059801976 9:117759106-117759128 TTAAGTGGGAGCTGAACACATGG - Intergenic
1062618729 9:137409858-137409880 TTAAGTGGAAGCTGCAAAACTGG - Intronic
1202778538 9_KI270717v1_random:14329-14351 TTCACTGGCAGCTGATTAAATGG + Intergenic
1186813825 X:13216246-13216268 TTTAGTACCAGCTGCTAAAATGG - Intergenic
1189279505 X:39811301-39811323 TTGCGTGGGAGCTGCTAAAAGGG + Intergenic
1190787114 X:53662431-53662453 TTAAATGTCAGTTCCTCAAATGG - Intronic
1193130956 X:77919429-77919451 TTAACAGGCTGCTGCCCAAAAGG - Intronic
1193891850 X:87057222-87057244 TAAACTGACAGCTCCTCAAATGG + Intergenic
1195672653 X:107482779-107482801 TTAAGTGGCAGCTCTTGAAGAGG + Intergenic
1195884318 X:109624197-109624219 CTAACTGGCAGCTGCTCCAGGGG - Exonic
1196120899 X:112049623-112049645 TTAAGTCTCAGCTACTCAGAAGG - Intronic
1196268200 X:113678121-113678143 TAATTTGGCAGCTTCTCAAAAGG - Intergenic
1196353354 X:114759274-114759296 TCAAATGGAAGCTGCTGAAAAGG - Intronic
1197174097 X:123466296-123466318 TTAAGTGGGGCCTGCTTAAATGG - Intronic
1199579846 X:149350304-149350326 TGAACTGGGATCTGCTCAAAGGG - Intergenic
1201332138 Y:12836087-12836109 TGTAGTGCCAGCTACTCAAAAGG - Intronic
1201612698 Y:15860946-15860968 TTAAGTTCCAGCTACTCAAGAGG - Intergenic