ID: 1028692516

View in Genome Browser
Species Human (GRCh38)
Location 7:93669538-93669560
Sequence CTTTATAACCTTATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028692516 Original CRISPR CTTTATAACCTTATGGAGCT GGG (reversed) Intronic
902667184 1:17947813-17947835 CATAATAACCTCATGAAGCTCGG - Intergenic
903082113 1:20819060-20819082 TTCTAAAATCTTATGGAGCTGGG - Intronic
908757549 1:67482698-67482720 CTTTATAACCATAGTGAGATGGG - Intergenic
909854118 1:80506768-80506790 CTTTATAAGGTTCTGGAACTTGG + Intergenic
910042903 1:82874910-82874932 CTTTATAGCCGTATGTAGATGGG - Intergenic
918796372 1:188902063-188902085 TTTTATAAGGTTATAGAGCTTGG - Intergenic
920771183 1:208887624-208887646 CTTTAGAAACTTAGGGATCTTGG + Intergenic
921782415 1:219181312-219181334 CTTCATAACCTTATGTGGTTAGG + Intronic
922964497 1:229677000-229677022 CTTTTTAACTTTATGGTGGTAGG + Intergenic
1064272381 10:13877499-13877521 CTTTTTGACCTCATGGAACTGGG - Intronic
1065632088 10:27690748-27690770 CTTAGTACCTTTATGGAGCTTGG - Intronic
1068891655 10:62154600-62154622 CTTTAAAACTTTCTGGAACTGGG - Intergenic
1075509558 10:123060036-123060058 GTTTCTAACTTTATGTAGCTGGG - Intergenic
1075534216 10:123256565-123256587 CTTTAAAACCTTCTGGGGCTGGG - Intergenic
1079892809 11:26079430-26079452 CTATATAACCTGATGGTGCTTGG - Intergenic
1086630387 11:89011035-89011057 CTTTATTAACTTATGGTGCAAGG + Intronic
1087905767 11:103695153-103695175 CCTTACAACATCATGGAGCTGGG - Intergenic
1094770782 12:33656025-33656047 CTTTATTACAATATGGAGGTTGG - Intergenic
1098679833 12:73338736-73338758 CTTTATAACCTTCTGTACCCAGG + Intergenic
1106877762 13:34093512-34093534 CTTTAAAACCTAATGGAAATTGG + Intergenic
1107186708 13:37530915-37530937 CTTTATAAACTTAGGGAGGAAGG + Intergenic
1108300911 13:49075184-49075206 CTATTTAACCTTATGAAACTGGG - Intronic
1111779592 13:92705416-92705438 TTTTATAGCCATATGTAGCTAGG - Intronic
1115278371 14:31633410-31633432 TTTTATAACATTTTAGAGCTTGG + Intronic
1115323677 14:32113554-32113576 CCTTATAACTTTATGGACCTTGG + Intronic
1116121830 14:40730598-40730620 CTTCATAACCTTCTGGTACTTGG + Intergenic
1121080718 14:91106010-91106032 CATTATAACCTTATGGGGCCAGG + Intronic
1127720282 15:61692410-61692432 CTTTATTACCTAATGAAGCAAGG + Intergenic
1133219089 16:4311069-4311091 CTTAATAATCTGTTGGAGCTGGG + Intergenic
1133619055 16:7508659-7508681 CTTTCCAACCTTGTAGAGCTGGG + Intronic
1141632680 16:85297013-85297035 CTTTATTGACTTATGGGGCTTGG + Intergenic
1146505504 17:33401200-33401222 TTTTTTAGCCTTATGGAGTTAGG - Intronic
1155001461 18:21691471-21691493 CTTTATGACCTTAGTAAGCTTGG - Intronic
1155996980 18:32340779-32340801 CTTTCTAACTTTATGGCCCTGGG - Intronic
1156627807 18:38930830-38930852 CAGTATAACATTATGAAGCTTGG - Intergenic
1159203101 18:65214204-65214226 GTTTCTAACCTTATGAAGCCAGG - Intergenic
1163606603 19:18279376-18279398 CTTTTTAACCTTTTGGTCCTTGG - Intergenic
1167416356 19:49375077-49375099 CTTTATTTCCATATGGTGCTTGG - Exonic
1167900457 19:52617807-52617829 CTTTCTAACCTGTTGGAGCAAGG - Intronic
926414900 2:12639920-12639942 CTTTATAGCCCTAAAGAGCTTGG + Intergenic
927472901 2:23388732-23388754 CTTTATATCTGTATGTAGCTGGG - Intronic
928100320 2:28433351-28433373 GTTTATTACCTTATGGTTCTAGG - Intergenic
929193212 2:39159230-39159252 CTTTATTACCTTATTTAACTGGG - Intergenic
929721372 2:44372061-44372083 CTTTAACAACCTATGGAGCTAGG - Intronic
931494961 2:62795494-62795516 CTTAAGAACCTTATGGAGAAAGG - Intronic
933272384 2:80247055-80247077 CTTCATTGCCTTATGGTGCTGGG - Intronic
939105673 2:137945699-137945721 CTTTATAATCTTATAGTTCTAGG + Intergenic
941775567 2:169389446-169389468 GTTAATAACTTTATAGAGCTGGG + Intergenic
943099749 2:183473462-183473484 TTTTTTAACCTTATGGTACTAGG - Intergenic
943401880 2:187422911-187422933 CTTTGTAATCCTAAGGAGCTAGG + Intronic
944053438 2:195497483-195497505 CTTTAGAACCTGTTGTAGCTGGG + Intergenic
946641855 2:221792441-221792463 CCTTTTAAGCTTATGGAACTGGG + Intergenic
948023130 2:234753565-234753587 CTTTATACCCTTTTGCAGTTCGG + Intergenic
1169055909 20:2620833-2620855 CTTTAAAACTTAATGGAGCTTGG + Intronic
1169617749 20:7469555-7469577 TTTTATAACCTTCTGGTACTTGG + Intergenic
1170734317 20:19000885-19000907 CTTTTTAACCTTCTGGAGTGAGG - Intergenic
1171956274 20:31466302-31466324 GTTAATAACCTTATCCAGCTGGG + Intronic
1172701629 20:36856665-36856687 CTTTGTAACCTTCTGGAGCTGGG - Intronic
1174497494 20:50958747-50958769 CTAAAAAACTTTATGGAGCTTGG - Intergenic
1178163736 21:29948283-29948305 TTTTATATTCTTATGGAGATGGG + Intergenic
1178737223 21:35163257-35163279 CTTATTAACCTTATTGATCTGGG + Intronic
1182733518 22:32513919-32513941 CTTCATAACCTTATGATGATTGG - Intronic
950705907 3:14781458-14781480 CTGTAAAACCATATGGACCTGGG - Intergenic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
952778851 3:37073685-37073707 CTTTAAAAGCTTAGGGTGCTAGG - Intronic
954967130 3:54621789-54621811 CTTTATAATCTAATAGACCTTGG - Intronic
955208820 3:56921761-56921783 TTTTATAATCTTGTTGAGCTGGG - Intronic
956526554 3:70169382-70169404 CTTCAAAACTTTATGGATCTAGG + Intergenic
957973963 3:87419662-87419684 TTTTATATCCTCATGGAGCAGGG - Intergenic
959403831 3:105936397-105936419 CTTTATAACCTGATGTGGTTTGG - Intergenic
962131005 3:132676336-132676358 CTTTATAACCTTGTTGAGCATGG + Intronic
964045147 3:152314673-152314695 CTTTTTAAAATTTTGGAGCTAGG - Intronic
964247200 3:154667196-154667218 GTTCATCTCCTTATGGAGCTGGG + Intergenic
966731457 3:183154785-183154807 CTGTATGACCTGATAGAGCTGGG + Intronic
973184425 4:47308410-47308432 TTTTATCCCCTTAGGGAGCTGGG + Intronic
975841315 4:78477388-78477410 CTTCATAACCTAATACAGCTTGG + Intronic
979089146 4:116456386-116456408 CTTTATAAACTTAGGTAGCCTGG - Intergenic
980622596 4:135328552-135328574 CCATATAAACTAATGGAGCTTGG - Intergenic
980726743 4:136771204-136771226 CTTTATAATCTTTTGAAACTAGG + Intergenic
982321284 4:154079839-154079861 CTTTATAAGCTTCTGCAGTTTGG - Intergenic
982738389 4:159031158-159031180 CTTTCTAACCTATTGGAGCTTGG - Intronic
983467187 4:168108928-168108950 CTTTATAACCTCATCTAGGTTGG + Intronic
984055351 4:174922038-174922060 CTTTTTAACCTTTGGGATCTTGG + Intronic
989700867 5:44263094-44263116 CATTATATCTTTATGAAGCTGGG + Intergenic
993072052 5:83177466-83177488 CTTTAAAAACATATCGAGCTTGG + Intronic
993947354 5:94131717-94131739 TTTAATATCCTCATGGAGCTGGG + Intergenic
994057630 5:95436677-95436699 CTTTATTCCTTTAAGGAGCTGGG - Intronic
994117434 5:96076447-96076469 CTTCATAACCCTAAGGGGCTCGG + Intergenic
996388660 5:122936122-122936144 CCTTTCAACCTTGTGGAGCTAGG + Intronic
1001129821 5:169054634-169054656 CTTTGTAATATTAAGGAGCTTGG - Intronic
1004402313 6:15299998-15300020 CATTATAACCTTTTGGAGGTTGG - Intronic
1008355977 6:50553737-50553759 GCTTATTACCTTATGGAGTTTGG - Intergenic
1009501789 6:64422480-64422502 CTTTAAAACCTTATGGTACTTGG + Intronic
1011892679 6:92186601-92186623 CTTTACAAACTTATGAAGTTTGG - Intergenic
1012181321 6:96156512-96156534 ATATATAAGCTGATGGAGCTGGG + Intronic
1013447057 6:110240440-110240462 CTTTATAACTATATGGAGGCTGG - Intronic
1017566714 6:155695043-155695065 CTTAATAACCTTTTGAAGCCAGG + Intergenic
1023557306 7:41436654-41436676 CTTTGTAACCTTAAAAAGCTTGG - Intergenic
1028444601 7:90906321-90906343 CTTTATAAATTTATGGAGATAGG + Intronic
1028692516 7:93669538-93669560 CTTTATAACCTTATGGAGCTGGG - Intronic
1038533692 8:28338822-28338844 CTTTGTAAAATGATGGAGCTGGG + Intronic
1043203948 8:77411581-77411603 CTTTATGACCTTACACAGCTGGG + Intergenic
1044195105 8:89366955-89366977 CTTTATAATCTCATGGGGCATGG - Intergenic
1044826324 8:96201169-96201191 CTTTATAAACTTATATGGCTGGG + Intergenic
1046500956 8:115076215-115076237 CTTGATAACTTGATGGATCTGGG + Intergenic
1051395217 9:16613076-16613098 CTTTCTAACCTTATGGTCCTAGG - Intronic
1055370188 9:75590111-75590133 CTTTATAACCGTAGGTAGATTGG - Intergenic
1056998093 9:91482969-91482991 CTTCATAACCTTATGTGGATAGG - Intergenic
1058605930 9:106723086-106723108 CTTTATGACCTTTGGGACCTTGG + Intergenic
1058863595 9:109141185-109141207 CATTATAACCTTCTGAAGGTAGG + Intronic
1059628901 9:116098202-116098224 TTTTATGACTTTAGGGAGCTTGG + Intergenic
1059869219 9:118552638-118552660 CTTTATAATGTCATAGAGCTGGG + Intergenic
1186936270 X:14453061-14453083 GTTTATAATCTTATGGATCTGGG + Intergenic
1187236645 X:17474304-17474326 CTTTATATCCTGAGAGAGCTAGG + Intronic
1191811968 X:65198704-65198726 TTCTATAACCTTCTGGAACTTGG + Intergenic
1193368923 X:80668892-80668914 CTTTATAAAATTATAGTGCTTGG + Intergenic
1197202618 X:123761479-123761501 CTGAATAACCTTGTGGAGCAAGG - Intergenic
1197583830 X:128318883-128318905 TTTTATTACTTTTTGGAGCTGGG + Intergenic
1198149911 X:133897992-133898014 TTTTATAGCCTTCTGGAGTTGGG + Intronic
1199082780 X:143595215-143595237 CTTTCTACCCTTCTGGAGCATGG - Intergenic