ID: 1028697377

View in Genome Browser
Species Human (GRCh38)
Location 7:93730826-93730848
Sequence CCATGTGCACAAAGAGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028697371_1028697377 -7 Left 1028697371 7:93730810-93730832 CCTGGCTCCCAGGGTGCCATGTG 0: 1
1: 0
2: 5
3: 28
4: 297
Right 1028697377 7:93730826-93730848 CCATGTGCACAAAGAGAAAGGGG No data
1028697370_1028697377 0 Left 1028697370 7:93730803-93730825 CCATGCTCCTGGCTCCCAGGGTG 0: 1
1: 0
2: 4
3: 49
4: 582
Right 1028697377 7:93730826-93730848 CCATGTGCACAAAGAGAAAGGGG No data
1028697367_1028697377 7 Left 1028697367 7:93730796-93730818 CCTGAAGCCATGCTCCTGGCTCC 0: 1
1: 2
2: 1
3: 64
4: 771
Right 1028697377 7:93730826-93730848 CCATGTGCACAAAGAGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028697377 Original CRISPR CCATGTGCACAAAGAGAAAG GGG Intronic
No off target data available for this crispr