ID: 1028706185

View in Genome Browser
Species Human (GRCh38)
Location 7:93849599-93849621
Sequence CAGTTTTAGGAGAGTGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 427}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028706181_1028706185 -2 Left 1028706181 7:93849578-93849600 CCAGCAGTGTTTTTCCAAGGGCA 0: 1
1: 0
2: 0
3: 12
4: 182
Right 1028706185 7:93849599-93849621 CAGTTTTAGGAGAGTGAAGAGGG 0: 1
1: 0
2: 0
3: 31
4: 427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028706185 Original CRISPR CAGTTTTAGGAGAGTGAAGA GGG Intronic
900760981 1:4470166-4470188 CATTTTGAGCTGAGTGAAGATGG + Intergenic
902051966 1:13570892-13570914 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
903459461 1:23510240-23510262 CAGGCTAAGGAGAGAGAAGAAGG - Intronic
903877146 1:26482756-26482778 CAGTATTAAGAAAGTGAAGAAGG - Intergenic
904124754 1:28230318-28230340 CTGTTTTCATAGAGTGAAGAGGG - Intronic
904844926 1:33403692-33403714 TAATTTTAGCAGAGTGGAGATGG - Intronic
905461952 1:38127870-38127892 CAGTCAAAGCAGAGTGAAGAAGG - Intergenic
906472405 1:46142197-46142219 TGGTTTTAGGAGGCTGAAGAGGG - Intronic
907589573 1:55653454-55653476 CAGTTATAGGAGACTGCACAAGG + Intergenic
908667604 1:66510182-66510204 CAGTTTTGGGAGGGAGAAGGTGG - Intergenic
909683936 1:78324548-78324570 CAGTATTAGGGAAGTGAAAAAGG + Intronic
910681621 1:89871446-89871468 TATTTTTAGGAGAGGGAAGGGGG - Intronic
910808094 1:91208507-91208529 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
910852974 1:91666627-91666649 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
911485860 1:98504398-98504420 AGGTTATAGGAGAGTGAAGGGGG - Intergenic
911685332 1:100769344-100769366 CAGATTTGGGAAAGAGAAGATGG + Intergenic
911967066 1:104383275-104383297 CAGTTTTAGGACAGGTAAAATGG - Intergenic
912055481 1:105592937-105592959 CAGTTTTAGTAAACTGAAGTGGG - Intergenic
912650893 1:111438260-111438282 CAGTTTTGGAAGAGTAAACAAGG - Intergenic
912815107 1:112822771-112822793 CAGTTTTAGGACAGGTAAAATGG + Intergenic
912816005 1:112829222-112829244 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
912816082 1:112829751-112829773 TAGTTTTGGGAGAGGGAAGCTGG - Intergenic
912980431 1:114366134-114366156 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
913231899 1:116746878-116746900 AAGGTTTAGGAGAGGGAGGAGGG - Intergenic
914736417 1:150421728-150421750 CACTTTTAGGAGGCTGAAGTGGG + Intronic
915265448 1:154713514-154713536 CAGGTTGAGGAGCGTCAAGATGG - Exonic
917449786 1:175137934-175137956 CAGTTACAGGAGTGTGGAGAAGG + Intronic
917693090 1:177489077-177489099 CAGTTTTTGGGGGGTGGAGAAGG - Intergenic
917714276 1:177718438-177718460 AAGTTGAAGGAGACTGAAGAGGG - Intergenic
919509589 1:198445202-198445224 CAGTTTTGGGAAAGTTAAAATGG + Intergenic
920036996 1:203072556-203072578 CAGTGATAGGAAAGTGAGGAGGG - Intronic
920910236 1:210209735-210209757 CAGTCTAGGGAGAGTGATGAAGG - Intergenic
921074624 1:211690402-211690424 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
921408490 1:214808879-214808901 CAGATTTTGGAGACTGAAGGTGG + Intergenic
922108240 1:222531326-222531348 CAGTTTTAGGAATGTGGAAAGGG - Intronic
922552316 1:226504890-226504912 CAGTTTAAGGAGATAGAAGTGGG + Intergenic
923681223 1:236120240-236120262 CATTTTAAGGAGGGTGGAGAGGG + Intergenic
1063412798 10:5849671-5849693 CAGCTTCAGGAGACTGAAGCGGG - Intergenic
1063688490 10:8260969-8260991 CAGTTATTTAAGAGTGAAGACGG + Intergenic
1064380209 10:14835075-14835097 CAGGTTTAGGGGAGTGAGAAGGG + Intronic
1064549960 10:16490339-16490361 CAGTTTTTGGAGATTACAGATGG - Intronic
1065930989 10:30479013-30479035 CAGTGTGAGGAGAGTCAGGAGGG - Intergenic
1067121798 10:43478605-43478627 CAGTTTTGGGAGGCTGAAGTGGG + Intronic
1068647867 10:59489185-59489207 CAGTTTTTAGAGACTGAAAAGGG - Intergenic
1068671813 10:59730648-59730670 CAGTCTGAGGAGAGTCATGAGGG + Intronic
1068675816 10:59768215-59768237 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1068764527 10:60748333-60748355 CAGTTTTCTCAGGGTGAAGAGGG + Intergenic
1070501653 10:77078322-77078344 CAGCTTTAGGGGAGGGAAGGTGG - Intronic
1072334787 10:94388416-94388438 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1072419659 10:95279426-95279448 CTGTATTAGAAGAGTCAAGAAGG - Intronic
1074290410 10:112133848-112133870 CAGTGGTGGGAGAGTGGAGAGGG - Intergenic
1074290523 10:112135118-112135140 CAGTAGTGGGAGAGTGGAGAGGG + Intergenic
1077509728 11:2951790-2951812 CAGTTTGAAGAAGGTGAAGAAGG - Exonic
1078922101 11:15840456-15840478 CAGTGTTAGGAGAGTTAAAATGG + Intergenic
1079683209 11:23323949-23323971 CATTTATAGGAGTGTGTAGAGGG + Intergenic
1079794859 11:24788505-24788527 CAGTTTGAGGACAAAGAAGAAGG - Intronic
1080017430 11:27522181-27522203 AAGTTTGAGGAGAGAGCAGAAGG - Intergenic
1080032724 11:27678927-27678949 TCGTTTTAGGAGGGTGAGGAAGG - Intronic
1081316271 11:41634656-41634678 CAGTTTTAATAGTGTGAATATGG + Intergenic
1081797104 11:45828195-45828217 CAGTTCTAGGACAGAGATGAAGG - Intergenic
1083089876 11:60189000-60189022 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1083867471 11:65464596-65464618 CATTTTTAAGAGAATGAAGACGG + Intergenic
1084298160 11:68226499-68226521 CAACTTGAGGAGAGTGGAGAAGG + Intergenic
1085325428 11:75602659-75602681 AAGTTTTGGGAAAGCGAAGATGG - Intronic
1085431543 11:76454918-76454940 CAGTATTAGGAGGGGGAGGAGGG - Intronic
1085568623 11:77539464-77539486 CAGTTTTAAGAGATGGAAGAAGG + Intronic
1086973476 11:93107689-93107711 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1087456819 11:98396880-98396902 CAGTTTGAGGAGAGTCAGGAGGG + Intergenic
1087894792 11:103575606-103575628 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1088093625 11:106073710-106073732 CAGTTTTAGGAAATTAAAGGCGG + Intronic
1088119922 11:106356382-106356404 CAGTTTTTGGAGAGAAAAAATGG + Intergenic
1088622401 11:111699277-111699299 AAGGTTTAGGAGAGAAAAGAGGG - Intronic
1088853618 11:113726203-113726225 CAGTGTTAGGGGGGTGAAGCGGG - Intergenic
1089111959 11:116064284-116064306 CTGTTTTGGGAGAGTAAAGAGGG - Intergenic
1090297570 11:125602584-125602606 CATTTGTAGTAGAGTGGAGATGG + Intronic
1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG + Intergenic
1090937257 11:131354169-131354191 CAGTGTTACGGGAGAGAAGAGGG - Intergenic
1091395261 12:150478-150500 CAGTTTCAGGTCAGTGAGGAGGG + Intronic
1091814531 12:3426525-3426547 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1092722199 12:11452287-11452309 CGGTTTTAGGAGAGTGATTCAGG - Intronic
1092951439 12:13507315-13507337 CAGTTTTAGAATAGAAAAGAAGG + Intergenic
1093356727 12:18176233-18176255 CAGTCTTAGGAGAGTCAAGGGGG - Intronic
1096059956 12:48688849-48688871 GAGTTTTAGGTGTGTGAAGTAGG + Exonic
1096218410 12:49811334-49811356 AAGTTATAGGAGAGTGGAGAGGG - Intronic
1097608833 12:61791149-61791171 CAGTTGTAGGAGAATGAAACTGG + Intronic
1097886718 12:64736306-64736328 CAGTTCTAGGAGAGAGAACCAGG + Intronic
1097956079 12:65486674-65486696 CAACTTTAGGAAAGTGGAGAGGG + Intronic
1097982405 12:65747761-65747783 CAATTTTAGGATAATGAAAAGGG + Intergenic
1098248377 12:68543781-68543803 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1098363339 12:69676940-69676962 GAATTGTAGGAGGGTGAAGATGG + Exonic
1098967881 12:76812288-76812310 CAGTTAAAGCAGAGTGATGATGG - Intronic
1098984238 12:76993440-76993462 CAGCTTTAAGAGTGTGAACAAGG + Intergenic
1099082604 12:78204460-78204482 CAGTTTGAGTAGAGTGAATTAGG + Intronic
1099677397 12:85779240-85779262 TACTTTTAGGAGAGTTAAGAAGG - Intergenic
1100057083 12:90524866-90524888 CAGTATCATGAGAATGAAGAAGG - Intergenic
1101982780 12:109422065-109422087 CAGCTTTGGGAGAGTGAGGTGGG - Intronic
1102428703 12:112864775-112864797 CAGTTTAAGGAAAGGGTAGAGGG - Intronic
1102518430 12:113465103-113465125 CAGGGTTTGGAGAGGGAAGAGGG - Intronic
1102586243 12:113924964-113924986 CAGTTTTAGAAGAAGGAAGTAGG + Intronic
1103673982 12:122641363-122641385 CACTTTTAGGAGACTGAGGTGGG + Intergenic
1104504473 12:129318626-129318648 CAGTTGTAGTAGTGTGGAGAGGG + Intronic
1105031691 12:132888306-132888328 CGGTTTTAAGAGGGTGAAGCAGG + Intronic
1106156582 13:27163460-27163482 TGGTTTTGGGAGAGAGAAGAGGG - Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107569847 13:41645231-41645253 TTATTTTAGGAGAGTGAAAAAGG + Intronic
1107800296 13:44100172-44100194 CAGTTTTATGACAATGAACATGG - Intergenic
1109909515 13:68891066-68891088 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1109947590 13:69457941-69457963 CAGTTTGAGGAAAATTAAGAAGG - Intergenic
1110337576 13:74349555-74349577 CAGTTAAAGGAGTGTTAAGAGGG + Intergenic
1110653728 13:77972602-77972624 CAGTCTAAAGAGAGTCAAGAGGG + Intergenic
1111100921 13:83585050-83585072 CACATTTAGTAGAGTGAAAAGGG + Intergenic
1112155072 13:96808319-96808341 TAGTTTCAGGAGAGTGAAAGTGG + Intronic
1112331551 13:98480833-98480855 CACTTTTGGGAGACTGAAGTGGG - Intronic
1114236106 14:20825016-20825038 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1116291251 14:43044870-43044892 AAATTTTGGGTGAGTGAAGATGG - Intergenic
1116800640 14:49439890-49439912 AAGTTTTAAGAGAGTGGAAAGGG + Intergenic
1117709929 14:58517164-58517186 CAGTGTTAAGAGAATGAAAAAGG + Intronic
1117966774 14:61214422-61214444 TAATTTTAGGAGATTGTAGAGGG - Intronic
1120917290 14:89721250-89721272 CAGCTTAAGGAGAGGGGAGAGGG - Intergenic
1121988322 14:98529564-98529586 CGGTTCTAGGAGAGAGGAGAGGG + Intergenic
1122258438 14:100498110-100498132 CAGTTTCAGGAGTGTGTTGATGG + Intronic
1122679168 14:103443905-103443927 CAGTTTCTGTAGAGTGATGAGGG + Intronic
1124588567 15:31033717-31033739 CAGTTATAGGAGAGAGAGGGTGG - Intronic
1126224373 15:46253264-46253286 CATTTTGAGGAGAGGGAAAATGG + Intergenic
1127513055 15:59662493-59662515 CAGTTATAGGAGAGAGATGCTGG - Exonic
1127695821 15:61446119-61446141 CAGTTTTAGTAGAGTGCTGGGGG + Intergenic
1128415472 15:67441681-67441703 CACATTTAGGAGAGTGAAACTGG + Intronic
1130241206 15:82193897-82193919 CAGAATGAGGAGAGTGAAGGCGG - Intronic
1130352599 15:83105673-83105695 GAGTTTAAGGAGAGTGGTGAAGG + Intergenic
1130459222 15:84147262-84147284 CAGAATGAGGAGAGTGAAGGCGG + Intergenic
1130577068 15:85102386-85102408 CAGTTTCAGGAGAATGGCGAGGG + Intronic
1133911634 16:10071485-10071507 CAGTGTTATTAGGGTGAAGAAGG - Intronic
1134421540 16:14095742-14095764 CAGATTTTGAAAAGTGAAGATGG - Intronic
1134761811 16:16721129-16721151 TAGTTTCAGGAGTTTGAAGAAGG + Intergenic
1134984247 16:18638041-18638063 TAGTTTCAGGAGTTTGAAGAAGG - Intergenic
1135290058 16:21228598-21228620 GAGTTTTAGGACAGTGCAGGAGG + Intergenic
1136072547 16:27796678-27796700 CTGTTTTAGGAGATTGAATGGGG + Intronic
1136357039 16:29751271-29751293 CAATTTTGGGAGACTGAAGCAGG + Intergenic
1136621259 16:31430167-31430189 CACTTTTGGGAGAATGAGGAGGG + Intergenic
1137387184 16:48052524-48052546 CAGATGTAGGAGAGTGAAAATGG + Intergenic
1138399148 16:56731279-56731301 CAGTTTGGGGAGAGTAATGAAGG - Intronic
1138993920 16:62425159-62425181 TAGTTTAAGGAAAGAGAAGAGGG - Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1141492433 16:84383185-84383207 CAGTTTTGGGACAGTGAGGCTGG - Intronic
1143377301 17:6474344-6474366 CAGAATGAGGAGAGTGAAGTCGG - Intronic
1143756868 17:9073693-9073715 CAGTTTTTGAAGAGAGAATATGG + Intronic
1145274781 17:21422936-21422958 CACTCCTAGGAGTGTGAAGAGGG + Intergenic
1145312632 17:21708835-21708857 CACTCCTAGGAGTGTGAAGAGGG + Intergenic
1145951586 17:28822512-28822534 CACTTTTGGGAGACTGAAGTAGG + Intronic
1146043994 17:29486884-29486906 CTGTTTAAGCAGAGAGAAGATGG + Intronic
1146471885 17:33131363-33131385 CAGTTTTATGAGAGAGGGGAGGG - Intronic
1146764143 17:35504179-35504201 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
1147395767 17:40141198-40141220 TTCTTTCAGGAGAGTGAAGATGG + Exonic
1147810324 17:43164376-43164398 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1152116700 17:78392386-78392408 CAGTTACTGGGGAGTGAAGAGGG - Intronic
1152138100 17:78517787-78517809 CAGTTGTAAGAGAGAGAAGCTGG - Intronic
1152365976 17:79856580-79856602 CAGTTTTAGAAGATAGAAGCTGG + Intergenic
1152454930 17:80409319-80409341 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1153388106 18:4522575-4522597 CTTTTTTAGTAGAGTGATGAGGG + Intergenic
1153830371 18:8917220-8917242 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1154014151 18:10601575-10601597 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1154058887 18:11039523-11039545 CAGTTAGAGGAGAGTGAGAAAGG - Intronic
1155198909 18:23500793-23500815 CAGTCTGAGGAGTGTGAAGAAGG + Intergenic
1155819565 18:30357513-30357535 AGGTTTTATGAGAGTGTAGAAGG - Intergenic
1157063983 18:44325488-44325510 CAGTTTTAGGATAGGGCAAAGGG + Intergenic
1157495203 18:48152055-48152077 CAGTCTTAGGAGTCTGAATATGG + Intronic
1158233942 18:55291489-55291511 CAGCTTTATGAAAGGGAAGATGG - Intronic
1158249132 18:55467265-55467287 AAGTTCAAGGAGAGGGAAGATGG - Intronic
1158886217 18:61829626-61829648 CGGTTGAAGGGGAGTGAAGAGGG + Intronic
1159061985 18:63524534-63524556 CAATTTTAGGAGGCTGAAGCGGG - Intergenic
1159399104 18:67907012-67907034 CAGTTTTAGGAACTAGAAGATGG + Intergenic
1161548601 19:4897761-4897783 CACTTTTGGGAGAGTGAGGCAGG - Intronic
1161791777 19:6364378-6364400 CAGGTTTAGGAGATGGAATAGGG + Intronic
1162281882 19:9705356-9705378 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1163498484 19:17661363-17661385 CAGTTGAAGGAGAGAGAAGGAGG + Intronic
1163991832 19:21006199-21006221 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1164121585 19:22270033-22270055 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1164130739 19:22358964-22358986 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1164820024 19:31242811-31242833 CAGTTCTAGGAGAGAGAACCTGG + Intergenic
1164859344 19:31550450-31550472 CAGAGTGAAGAGAGTGAAGATGG + Intergenic
1166220049 19:41358349-41358371 CAGTTATAGGAGACTGACCAAGG + Intronic
1166569642 19:43785301-43785323 CTGGTGAAGGAGAGTGAAGAGGG + Intergenic
1167651956 19:50736343-50736365 CAATTTTAAAAGACTGAAGATGG - Intergenic
925537423 2:4932600-4932622 CTTTTTTAGAAGAGTAAAGAAGG - Intergenic
925677365 2:6378184-6378206 CAGATGTAGGAGAGTGAAACTGG + Intergenic
926462618 2:13151135-13151157 CAGTTATAGGTAATTGAAGATGG + Intergenic
926491474 2:13530134-13530156 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
930769794 2:55119929-55119951 CAGATGCAGGAGGGTGAAGATGG + Intergenic
930874142 2:56194542-56194564 CAGTTTTAGCAGTGACAAGAAGG + Intronic
931802563 2:65772823-65772845 CAATATTAAGAGAGTGATGATGG + Intergenic
931851567 2:66256438-66256460 CAGTTTTAGGAGTGTCAAAAGGG - Intergenic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
932299943 2:70659596-70659618 TAGTTATAGGAGAGTGGAGGGGG + Exonic
933906773 2:86901925-86901947 CAGTTTAAGAAGTATGAAGAGGG + Intergenic
934024703 2:87991709-87991731 CAGTTTAAGAAGTATGAAGAGGG - Intergenic
935048394 2:99502485-99502507 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
935519383 2:104085178-104085200 CAGTTTTTGGAGGGTGAAGCTGG - Intergenic
936277639 2:111114319-111114341 CGGTTATAGGAGAGTGATAATGG + Intronic
936365391 2:111849746-111849768 CAGTTTAAGAAGTATGAAGAGGG - Intronic
936467500 2:112766290-112766312 CAGTTTCAGAAAAGTGAAGGCGG + Intergenic
937553699 2:123128461-123128483 GAGTTCTAGAAGAGTGAATAAGG + Intergenic
938570927 2:132561245-132561267 CAGGTTTAGGAGAGAAAAGAAGG - Intronic
938663011 2:133506519-133506541 CAGTGTGAGGAGAATGAAGTGGG + Intronic
938703145 2:133897329-133897351 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
939327072 2:140706021-140706043 CAGTTTTACGAGCTTGGAGAGGG - Intronic
939719006 2:145623840-145623862 TAGTTATGTGAGAGTGAAGAAGG - Intergenic
939830339 2:147063809-147063831 CAGGTTGAGGTGAGTGCAGATGG + Intergenic
943408071 2:187513942-187513964 CAGTCTGAGGAGAGTCAGGAAGG - Intronic
943513083 2:188850806-188850828 CAGTTATAGGCAAATGAAGAGGG - Intergenic
945097647 2:206234696-206234718 CAGAGTTATGAGAGTAAAGAAGG - Intergenic
945188388 2:207163072-207163094 CGGTTTTGGGAGGGGGAAGAAGG + Intronic
945275981 2:207988128-207988150 GTGTTTGAGGAAAGTGAAGATGG - Intronic
945289724 2:208115356-208115378 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
946442148 2:219705573-219705595 CATTTTTAGTGGAGAGAAGAAGG + Intergenic
946744892 2:222835861-222835883 CAGCTTTAGTAGAGAGAAGCTGG + Intergenic
947125943 2:226868476-226868498 CAGATTAAGGAAAGTGAAGCTGG - Intronic
947708506 2:232295255-232295277 GAGTTTGAGGAAAGTGATGAAGG - Intronic
948620637 2:239232354-239232376 CAGTTTGAGGACAGAGGAGAAGG - Intronic
1169153220 20:3306822-3306844 TGGTTTTAGGAGAGTGTTGAAGG - Intronic
1169763179 20:9119565-9119587 CAGTTTTAGGAGAGATGAAAAGG + Intronic
1169797787 20:9483535-9483557 GAGATTATGGAGAGTGAAGAAGG + Intergenic
1170434674 20:16314303-16314325 CACCTTTAAGAGAGTGAAAAGGG - Intronic
1171165626 20:22967675-22967697 CAGCTGTAGTAGGGTGAAGAGGG - Intergenic
1172016641 20:31879568-31879590 CAGTTTAAGGAAAGTGCAGTTGG + Intronic
1173679372 20:44866594-44866616 CAATTTTAGGGGTGTCAAGAAGG - Intergenic
1174126962 20:48313527-48313549 CTGTCATAGGAGCGTGAAGAAGG + Intergenic
1175513892 20:59555753-59555775 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1177069445 21:16485269-16485291 TTGTTTTAGGAGGCTGAAGATGG + Intergenic
1177384303 21:20389003-20389025 GAGTTTTAGGGGAGGGGAGAAGG - Intergenic
1177522614 21:22247529-22247551 CATTATTAGCAGAGTGAAAATGG + Intergenic
1178267544 21:31158051-31158073 CATTTTTAAGAGTGTGAACAGGG + Intronic
1179447835 21:41445647-41445669 CAGCCTTGGGGGAGTGAAGAAGG - Intronic
1179670902 21:42946931-42946953 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1180737858 22:18031998-18032020 CATTTTTAGGAAAATGAAGAAGG - Intergenic
1181024813 22:20122123-20122145 CAGTTCTTGGAGCCTGAAGAAGG + Intronic
1182253560 22:29021281-29021303 CAGTTTTAGTAGATAGCAGAAGG + Intronic
1183647241 22:39133864-39133886 CAGTTTAAGAAGAGTAAAAACGG + Exonic
950674555 3:14546756-14546778 CATTTTGAGGAGAGTCAAGTGGG - Intergenic
950846158 3:16017853-16017875 CAGTTTGAGGAGAGCCAGGAGGG + Intergenic
951019787 3:17770043-17770065 AATTTTTAGGAGAATGAAGATGG + Intronic
951248570 3:20368156-20368178 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
951293423 3:20902360-20902382 CAGTCTTAGGAGTGTGAGAATGG + Intergenic
952522735 3:34178383-34178405 CAGCTTTGGCAGAGTGAAGAAGG + Intergenic
952894525 3:38068976-38068998 CAGATATGGGAGAGGGAAGAGGG + Intronic
953684932 3:45069837-45069859 TAATTTTAGCAGAGTGGAGATGG + Intergenic
954362625 3:50130290-50130312 CAGTTTCAAGAGGCTGAAGAAGG - Intergenic
954604723 3:51900530-51900552 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
954765627 3:52913328-52913350 CATGTTTTGGACAGTGAAGAGGG - Intronic
955871995 3:63449092-63449114 CAGTATTGGGAGAGGAAAGAAGG + Intronic
957999938 3:87737748-87737770 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
958255959 3:91325156-91325178 CAGTTTTAGGAGGGTTCATATGG - Intergenic
959546056 3:107598016-107598038 CAGTTTTAGGAGAGGGTACTTGG + Intronic
959557091 3:107733040-107733062 CAGTATGAGCAGAGTGGAGACGG - Intronic
959569043 3:107862241-107862263 CAGTTATAGCAGTGTGAAAATGG + Intergenic
959630912 3:108506335-108506357 CAGGTTGAGGAGAGAGAATATGG + Intronic
960294385 3:115925164-115925186 CTATTTTTGGAGAGTGTAGAGGG + Intronic
960720372 3:120619286-120619308 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
960959404 3:123058746-123058768 CAGCTTCAGGAGAATGAAGCTGG - Intergenic
961961012 3:130855109-130855131 CAGGATTAGAAGGGTGAAGATGG - Intronic
962097360 3:132306220-132306242 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
962277050 3:134023441-134023463 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
962896625 3:139721116-139721138 AAGTTTCAGGACAGTGAATAGGG - Intergenic
963097804 3:141564204-141564226 CAGTTATATGAGAGTAAAGAGGG + Intronic
963596892 3:147339392-147339414 CATTTTTAGGAGAGAGAAGGGGG + Intergenic
964130249 3:153279009-153279031 CAGTTTCAAGAGAGGGAGGAGGG - Intergenic
964160679 3:153641215-153641237 CAGCTGTAGTAGTGTGAAGAGGG - Intergenic
964660912 3:159119336-159119358 TAGTTTTATAAGACTGAAGATGG - Intronic
964814051 3:160697701-160697723 CAGTATGAGTAGAGTGAAAATGG + Intergenic
964933033 3:162048700-162048722 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
965449942 3:168825289-168825311 CAGTTTTAAGACAATAAAGAAGG + Intergenic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
969160390 4:5252645-5252667 CACTTTTAGGAGAATGAAAAAGG + Intronic
970092621 4:12427299-12427321 CAGTCTGAGGGGAGTCAAGAGGG + Intergenic
970724599 4:19028903-19028925 GAGGTTTAGGAGAATGAAAAAGG + Intergenic
971816325 4:31495536-31495558 TGGTTTTAAGAGAGAGAAGAAGG - Intergenic
972784969 4:42318309-42318331 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
973943482 4:55933598-55933620 TAGTTTTAGGGGAGTGAAGGAGG + Intergenic
975177188 4:71301412-71301434 CGGAGTTAGGAGAGGGAAGAAGG + Intronic
975205632 4:71641802-71641824 CAGTCTGAGGAGAGTCAAGAGGG - Intergenic
975973919 4:80073333-80073355 CAGATTTGGGAAAGGGAAGAAGG + Intronic
976078139 4:81322133-81322155 CAGCTATAGCAGAGTTAAGAGGG + Intergenic
976356645 4:84126611-84126633 CAGTATTAGGAATGTAAAGAAGG + Intergenic
976418164 4:84803418-84803440 CATTTTTAGGAGGGTAAACAGGG + Exonic
976956451 4:90906852-90906874 AAGATTTAGGAGAGTTAAAATGG - Intronic
977043586 4:92042582-92042604 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
977972361 4:103227261-103227283 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
978036484 4:104001606-104001628 AAGTTTTAGGAGTGAGAATAGGG - Intergenic
979105739 4:116684564-116684586 AAGTTTTAGCAAAGTGATGAAGG + Intergenic
980438811 4:132814914-132814936 CAGTCTGAGGAGAGTCAGGATGG + Intergenic
980742512 4:136970825-136970847 CAGCTTGATGAGAGTGCAGAAGG - Intergenic
981231751 4:142364740-142364762 CAGATTCAGGAGACTGCAGAAGG + Intronic
981252714 4:142623460-142623482 CTGTTTTAGGAGAGTGACTGTGG - Intronic
982547545 4:156753890-156753912 CCGTTTTAGAAAAGTGAAAATGG + Intergenic
982968991 4:161955934-161955956 CAGTGTTCCGAGAGTGTAGAAGG - Intronic
983210791 4:164955838-164955860 CAGTTTTATGAGATTAAAGAGGG + Intronic
983506493 4:168558545-168558567 CAGAGTTCGGAGAGGGAAGAAGG - Intronic
983708420 4:170686649-170686671 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
983897953 4:173102063-173102085 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
984307370 4:178011330-178011352 CAGCTTTAAGAGAATGAAAAAGG - Intergenic
984622833 4:181973474-181973496 CAGCTTTGGGAGATTGAAGCAGG + Intergenic
985171437 4:187154189-187154211 AAGTGTGAGGAGAGTGAAGGAGG + Intergenic
985896934 5:2754236-2754258 CAGTGTTGGGAGTTTGAAGATGG + Intronic
986372817 5:7097831-7097853 CAATTGGAGGAGAGAGAAGAGGG + Intergenic
986448817 5:7846993-7847015 CTATTTTAGGAGACTGAGGAGGG - Intronic
986854488 5:11853153-11853175 CAGTTTTGGTGGAGTGATGAGGG - Intronic
987930556 5:24395004-24395026 CAGTGTGAGGAGAGTCAGGAGGG + Intergenic
989096060 5:37782259-37782281 CAGTATGAGGAGAGTCAGGAGGG + Intergenic
989698242 5:44230569-44230591 CAGTTTCAGAAAAGTGATGAAGG + Intergenic
990555545 5:56931348-56931370 AAGTTTTAAGGAAGTGAAGATGG + Intronic
992602426 5:78415963-78415985 CAGTGTTAGGAGGTAGAAGATGG + Intronic
993365891 5:87033818-87033840 TTGTTTCAGGAGAGTAAAGATGG + Intergenic
993552199 5:89287282-89287304 CAGTATGAAGAGAGAGAAGATGG + Intergenic
994772979 5:104007013-104007035 CAGTTATATGGTAGTGAAGAGGG - Intergenic
994840628 5:104920799-104920821 TTGTTTTAGCAGAGTGGAGAGGG - Intergenic
994904362 5:105817691-105817713 CAGTTTTTGGAGGCTGAAAAAGG + Intergenic
995163509 5:109009890-109009912 GTGTTTTAAGACAGTGAAGATGG + Intronic
995758269 5:115536058-115536080 CAGTTTCAGGGGAATGAGGAGGG + Intronic
995847769 5:116512441-116512463 CACATTTTGGAGAGTGATGATGG + Intronic
995867408 5:116706532-116706554 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
996432737 5:123399904-123399926 TAGTATGAGGAGACTGAAGAGGG + Intronic
997279664 5:132631991-132632013 CAGCTTTAGGAAAATGAAGCTGG - Intronic
997639207 5:135437586-135437608 CTGTTTCAGGGGAGGGAAGAGGG - Intergenic
997986254 5:138503804-138503826 AAATTTTAGGAAAGTGGAGAGGG - Intergenic
998004345 5:138647310-138647332 CAGTTCTAGGAGGGTGGAGATGG + Intronic
998552501 5:143090896-143090918 CAGTCTTAGGAGACTCAGGAGGG + Intronic
999031556 5:148298777-148298799 CAGTTTTAGGAGTCTGAGAAAGG - Intergenic
1000236810 5:159369685-159369707 CAGTCTGAGGAGAGTCAGGAAGG - Intergenic
1000707172 5:164526327-164526349 CTGTGATAGCAGAGTGAAGAGGG - Intergenic
1000904757 5:166951582-166951604 CAGTTTTAGTACTGTGAAAATGG + Intergenic
1001923906 5:175622322-175622344 GAGTTTGAGGAGGGAGAAGAGGG - Intergenic
1001925180 5:175630974-175630996 CAGGTTTAGGGAAGAGAAGAAGG + Intergenic
1002775900 6:327322-327344 CAGCTGGAGGAGAGTGAAGGTGG + Intronic
1002999132 6:2314572-2314594 CAGTCTGAGGAGAGTCAGGAAGG + Intergenic
1003170242 6:3715884-3715906 CAATTTTAGTGGAGTGATGAGGG - Intergenic
1003942044 6:11039020-11039042 CAGTTTTAGTAGAGTGGTTAGGG + Intronic
1004800565 6:19142404-19142426 CGGTTTTGGCAGAGTGCAGAGGG - Intergenic
1005065032 6:21809345-21809367 CAGATTTAATAGAGTGCAGAGGG - Intergenic
1005440123 6:25858338-25858360 CAGTGTTTTGAGAGTGAAAATGG - Intronic
1005461922 6:26077563-26077585 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1006325793 6:33352865-33352887 CAGTGTGAGGAGAGTCAGGAGGG + Intergenic
1007590618 6:43018595-43018617 AAGTGTCAGGAGTGTGAAGAGGG - Intronic
1007819484 6:44550518-44550540 TTGTTTTGGGAGAGGGAAGACGG - Intergenic
1008123454 6:47643992-47644014 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1008465750 6:51828925-51828947 CATTTTTTGGAGATAGAAGAGGG + Intronic
1009187869 6:60595422-60595444 CAGTTTTAGGAGGGTTCATATGG + Intergenic
1009379284 6:63008387-63008409 CAGTTTTAGGACAGGTAAAATGG - Intergenic
1010743185 6:79531234-79531256 CAGTTTTAGCAGAGTTGAGAGGG - Intronic
1011129010 6:84034951-84034973 CAGGTGCAGGAGAGTGACGAGGG + Intronic
1011601954 6:89067889-89067911 GAGTTTCAGGGGAGAGAAGAGGG - Intergenic
1012754456 6:103207490-103207512 AACTATTAGGATAGTGAAGAAGG - Intergenic
1012961047 6:105622097-105622119 AAATTTCATGAGAGTGAAGAAGG - Intergenic
1014465169 6:121748140-121748162 AAGTTTTAGTTGAGTGAAAAGGG + Intergenic
1015889786 6:137958876-137958898 CAGTTTTACAAGATGGAAGAAGG - Intergenic
1016113998 6:140260069-140260091 CAGTTTTTGGACAGGTAAGATGG + Intergenic
1016560223 6:145388341-145388363 TGGTTATAGTAGAGTGAAGAGGG - Intergenic
1017078410 6:150641732-150641754 CAGTTTCAGGGGAGGGAAAAAGG - Intronic
1017967538 6:159279564-159279586 AAAGTTTAGGAGAGGGAAGAGGG + Intergenic
1018725001 6:166605082-166605104 CAGTTCTAGGAGAGGCAAGAGGG - Intronic
1020014905 7:4825184-4825206 CAGTTCTAGAAGAGGGCAGAGGG + Intronic
1020043911 7:5025353-5025375 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1020655767 7:10926717-10926739 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1021055952 7:16046436-16046458 CAGTTTTAAAAGTTTGAAGATGG + Intergenic
1021631764 7:22654592-22654614 CAGTCTTCAGAGAGAGAAGAAGG - Intergenic
1022057052 7:26748036-26748058 CAGTTTTAAATGAGTGGAGAAGG - Intronic
1023799091 7:43817976-43817998 CAGTCTGAGGAGAGTAAGGAGGG - Intergenic
1024782474 7:52867005-52867027 CTGTTTAAGGAGATTGAAGATGG - Intergenic
1024812927 7:53234896-53234918 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1025233940 7:57220982-57221004 TAGTTTAAGGATAGTGAAGCTGG + Intergenic
1026044071 7:66893590-66893612 GAGTTGTATGAGAGTGAGGAGGG + Intergenic
1026627773 7:72011482-72011504 CAGGTTCAGGAGAGGGAACAGGG - Intronic
1027613500 7:80392029-80392051 CAGTTTTTGAAAAATGAAGAAGG + Intronic
1028333967 7:89628680-89628702 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1028390156 7:90306489-90306511 AACTTTTAGGAGAATGAACATGG - Intronic
1028706185 7:93849599-93849621 CAGTTTTAGGAGAGTGAAGAGGG + Intronic
1029822051 7:103156073-103156095 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1029944668 7:104519518-104519540 CAGTTTAGGGAGGGAGAAGAAGG + Intronic
1030243533 7:107356877-107356899 CAGTTTTAAGATATTTAAGAAGG - Intronic
1032155173 7:129462130-129462152 TGGTTTGAGGAGAGAGAAGATGG + Intronic
1032170537 7:129581046-129581068 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1032254343 7:130285084-130285106 CAGTTTCAGAAGAGTGGATAAGG + Intronic
1033530924 7:142263311-142263333 AAGTTTGAGGAGAGAGGAGAGGG + Intergenic
1033623724 7:143087714-143087736 CATTTGTAGGAGAATGAAAATGG + Intergenic
1033984063 7:147200983-147201005 ATATTTTAGAAGAGTGAAGATGG + Intronic
1035762560 8:2080301-2080323 CAGCTCTAGGAGAGAGAACACGG - Intronic
1035920847 8:3674745-3674767 CATTTTTTGAAGAGTGAAGTTGG - Intronic
1038089650 8:24239134-24239156 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1038259600 8:25981296-25981318 CAGTGCTAGGTGAGGGAAGATGG - Intronic
1038379504 8:27079325-27079347 GAGTGTTCGGAGGGTGAAGAAGG - Intergenic
1038528130 8:28294691-28294713 GAGTTTTAGGACAGAGAAAATGG + Intergenic
1038546212 8:28427504-28427526 CAGAGTTAAGAGGGTGAAGAAGG - Intronic
1039826049 8:41174941-41174963 CACTTGTAGGAGAGATAAGAGGG + Intergenic
1040001734 8:42582776-42582798 CATTTTTGGGAGGCTGAAGAAGG - Intergenic
1040890298 8:52310178-52310200 CAGTTTAATGGGAGTGATGATGG + Intronic
1040993413 8:53376263-53376285 CAGTCTAAGGAGAGTCAGGAGGG + Intergenic
1041383935 8:57279422-57279444 CAGCTTCAGGAGAGTGAGAAAGG + Intergenic
1041701222 8:60791216-60791238 CAGGTTTAGGAGAGGAATGAGGG + Intronic
1042158293 8:65867188-65867210 GAGGTCTAGGAGAGTGAGGACGG - Intergenic
1042610407 8:70593526-70593548 CAGGTGAAGGAAAGTGAAGAGGG - Intronic
1043098897 8:76014436-76014458 GACTTTTAGGAGAGAGAAGAAGG - Intergenic
1043403454 8:79906518-79906540 AAGTTTGAGGAAACTGAAGAGGG - Intergenic
1044741325 8:95329557-95329579 CATGTTTAGGAGAGTGCAGTTGG - Intergenic
1046158557 8:110328555-110328577 CAGTTTTAGTAGGGAGAAAAGGG - Intergenic
1047120680 8:121900792-121900814 CAGGTTTAAGAAAGTGAAGAAGG + Intergenic
1047171080 8:122492700-122492722 CTGTTGTAGGTGGGTGAAGATGG + Intergenic
1049236748 8:141515933-141515955 CAGTGTGAGGAGAGAGACGATGG - Intronic
1050188183 9:2997203-2997225 CAGAGTTAGGAGAATAAAGAAGG - Intergenic
1050360989 9:4830959-4830981 TAGTTTTAGCAGAGTGATGGTGG - Intronic
1051111199 9:13638719-13638741 AAGTTTGAGGAGGGTGAAAAAGG + Intergenic
1051318631 9:15873978-15874000 CAATTCTAGAAGAGTGAAAAGGG + Intronic
1051718231 9:20008195-20008217 CAGGCTTAAGAGAGGGAAGAGGG - Intergenic
1052508073 9:29380709-29380731 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1053036226 9:34828589-34828611 CAGATTTAGATGAGTGATGAAGG - Intergenic
1053485941 9:38456384-38456406 GACTTTTAGGAGAGTGAAACAGG + Intergenic
1053486143 9:38457870-38457892 CTGTTTCAGCAGAGTGATGAGGG + Intergenic
1055125393 9:72713492-72713514 CAGTTTTAGGAGGGTGTATGTGG + Intronic
1056414437 9:86362616-86362638 CAGTCTGAGGAGAGTCAGGAAGG + Intergenic
1058418385 9:104811521-104811543 AAGTCTTAGGAGGTTGAAGAAGG - Intronic
1058501845 9:105627270-105627292 CACTATTAAGAGAGTAAAGAAGG - Intronic
1058929381 9:109704048-109704070 CAGTTTTAGGACAGTGGTGAGGG + Intronic
1058942922 9:109830899-109830921 CAATTTTAAGAGACTGCAGAGGG - Intronic
1059676622 9:116546540-116546562 CTGTCCTAGGAGTGTGAAGATGG + Intronic
1059803508 9:117774110-117774132 AAGTTTGAGGAGTGTGAGGAAGG - Intergenic
1186721260 X:12306889-12306911 CATTTTTAGATGAGTGTAGATGG + Intronic
1186751769 X:12628820-12628842 CTTTATTAGGAGTGTGAAGACGG - Intronic
1187076105 X:15936875-15936897 CAGTTTTTGGACAGAGGAGAGGG - Intergenic
1187766437 X:22647723-22647745 AGGTTTGAGGAGAGTGGAGAAGG + Intergenic
1187842464 X:23503237-23503259 GAGTTTCAGTAGAGTTAAGATGG + Intergenic
1188200817 X:27291764-27291786 CAGTTTTTGGACAGGTAAGATGG + Intergenic
1188675753 X:32937108-32937130 CAGTGTTAGGAAATTCAAGAAGG + Intronic
1189034549 X:37482484-37482506 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
1189094994 X:38128836-38128858 CATTTTTAGGGGAGGTAAGAGGG + Intronic
1189833887 X:45001514-45001536 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1190017550 X:46840340-46840362 CAGTCTTAGGGGACTGAAGCTGG + Intronic
1190270251 X:48857614-48857636 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1190771205 X:53516264-53516286 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1190976465 X:55407044-55407066 CAGTATTTGGAGAGTGTAGTGGG + Intergenic
1191639219 X:63412530-63412552 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1191724069 X:64260308-64260330 CAGGAGCAGGAGAGTGAAGAGGG - Intergenic
1191917993 X:66222732-66222754 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1193717315 X:84948273-84948295 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1193997892 X:88389418-88389440 CATTTGTAGAAGAATGAAGATGG + Intergenic
1194366605 X:93020846-93020868 CATTCCTAGGAGAGAGAAGAAGG + Intergenic
1194702719 X:97134115-97134137 CAGTTTTAGGTGAAGGATGAAGG + Intronic
1195349113 X:103980161-103980183 CATTTTTGAGACAGTGAAGAAGG - Intergenic
1195358330 X:104058678-104058700 CATTTTTGAGACAGTGAAGAAGG + Intergenic
1195846865 X:109238228-109238250 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1196373157 X:115001153-115001175 CAGTTTTAGGGGCAGGAAGATGG + Intergenic
1196423019 X:115541848-115541870 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1196460054 X:115920360-115920382 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1196869391 X:120098587-120098609 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1197887304 X:131231773-131231795 CAGATTTCAGGGAGTGAAGAAGG + Intergenic
1198228272 X:134666506-134666528 CAGTCTTAGGAGGGTGAACATGG + Intronic
1198742457 X:139855778-139855800 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
1199638339 X:149835062-149835084 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1199974138 X:152882658-152882680 GAGTTTTAGGAGAGAGATGTAGG - Intergenic
1200674832 Y:6137107-6137129 CATTCCTAGGAGAGAGAAGAAGG + Intergenic
1201260088 Y:12150256-12150278 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1201278779 Y:12322335-12322357 CAGATTTATGACAGAGAAGATGG + Intergenic
1201308891 Y:12576729-12576751 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic