ID: 1028708274

View in Genome Browser
Species Human (GRCh38)
Location 7:93876055-93876077
Sequence AACATTTAACTGCTAATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028708274_1028708275 -4 Left 1028708274 7:93876055-93876077 CCTGTTATTAGCAGTTAAATGTT 0: 1
1: 0
2: 1
3: 11
4: 202
Right 1028708275 7:93876074-93876096 TGTTTGTTTTAACATTTGTTAGG 0: 1
1: 0
2: 8
3: 94
4: 894

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028708274 Original CRISPR AACATTTAACTGCTAATAAC AGG (reversed) Intronic
901337933 1:8467596-8467618 AACATTTAACTGCCAACAAAAGG + Intronic
903529026 1:24015410-24015432 AACATTTACCAGCACATAACTGG - Intergenic
903874811 1:26466563-26466585 AACAATGAACTGCTAATTCCTGG + Intronic
904639789 1:31916860-31916882 AACATTTAATTGTTAATAACTGG - Intronic
908859038 1:68462608-68462630 ATTAGTTAACTGCTAATAATAGG - Intergenic
909129923 1:71722082-71722104 AACAATTAAGTGCTATTATCTGG + Intronic
909879204 1:80851322-80851344 AAATTTTAACTGTAAATAACTGG - Intergenic
909962850 1:81868803-81868825 AACATTCTAGTGCAAATAACAGG - Intronic
909964080 1:81885950-81885972 AACAGTTAACTGAAATTAACTGG + Intronic
910615127 1:89189080-89189102 AACTTTTTACTGCTCATTACTGG - Intronic
911015546 1:93328350-93328372 CAAATTTAAATGCTAATAAATGG - Intergenic
916332413 1:163632047-163632069 TACATTTAACTGGAAATAAAGGG - Intergenic
918124733 1:181573092-181573114 AAAATTAAATTGCTAATAAATGG - Intronic
919577521 1:199330260-199330282 AACATTTGAGTGCTAACCACAGG + Intergenic
921643772 1:217588263-217588285 AAGACTCAACTGCTAAGAACTGG + Intronic
923615737 1:235535531-235535553 AACACTTACCAGCTAGTAACTGG - Intergenic
1063618182 10:7620595-7620617 TAAATTTAAATGTTAATAACTGG - Intronic
1063819244 10:9815814-9815836 AACACTTAACTGTGAATAAACGG - Intergenic
1065543285 10:26791855-26791877 TACATTTAAATGCAAATAAATGG + Intronic
1065610837 10:27469372-27469394 AACATTTCACTGCTATTTTCGGG - Intergenic
1066151714 10:32628294-32628316 AACAATTACATGCCAATAACTGG - Intronic
1069357199 10:67600135-67600157 AACATCTAAATGCTTATAAATGG + Intronic
1070186666 10:74069917-74069939 AATATTAAACTATTAATAACTGG + Intronic
1072363669 10:94686601-94686623 AACATATAACCTTTAATAACTGG - Intronic
1074922265 10:118027327-118027349 AACATTGAAATACTAATAATAGG - Intronic
1075508677 10:123050443-123050465 AACAATTTCCTGCAAATAACAGG - Intronic
1075929290 10:126281808-126281830 ATCAATTAACTGCTAATCAATGG + Intronic
1079298920 11:19260058-19260080 AACAATTAACAGCAAATAAATGG - Intergenic
1081215493 11:40391686-40391708 AACATTTGACCGGTAAAAACAGG - Intronic
1081249925 11:40816713-40816735 GCCATTTAAATGCAAATAACTGG + Intronic
1082672744 11:56055333-56055355 AACATTTACCTGCAAATATATGG + Intergenic
1082834449 11:57641241-57641263 AACATTGCACTGCTAGTGACAGG - Intergenic
1085960825 11:81459497-81459519 GACATTTAACTGTAAATTACAGG + Intergenic
1087240842 11:95776321-95776343 AAAGCTTAACGGCTAATAACTGG + Intronic
1095328156 12:40923147-40923169 AATATTTAACTTCTAATAGTAGG + Intronic
1097143131 12:56920006-56920028 AAGATTACACTGCTAATAAATGG - Intergenic
1097824171 12:64157683-64157705 CACATTTAACTACTATTATCTGG - Exonic
1098636294 12:72788093-72788115 AATATTTAATTCCTAAAAACAGG + Intergenic
1098854347 12:75635418-75635440 AACATCCAAGTGCTAATATCTGG - Intergenic
1098897051 12:76075454-76075476 AGCACTTAACTGCTAAAATCAGG - Intronic
1099038972 12:77626783-77626805 AGCATTTAAGTCCTAATGACTGG - Intergenic
1099218896 12:79888763-79888785 ACCATTTAACAGATGATAACTGG + Intronic
1099346696 12:81509179-81509201 AACATCTCACTGATAATAATTGG - Intronic
1099505852 12:83475241-83475263 AACATTTACCTGCATATCACTGG + Intergenic
1099532669 12:83804227-83804249 CACTTTCAACTACTAATAACGGG + Intergenic
1100552912 12:95663331-95663353 AAAATATAAATGCTAATAAGAGG - Intronic
1104239116 12:126969898-126969920 AACATTTAAATTCTAATGTCTGG + Intergenic
1105743184 13:23350393-23350415 CATATTTAACTGCTAATAAAAGG + Intronic
1105744616 13:23365481-23365503 AAAATTTAAGTGCAAATAATTGG - Intronic
1106639242 13:31565749-31565771 AACAGTTAATTCCTAGTAACGGG + Intergenic
1108545891 13:51492985-51493007 AAAATGAAACTGCAAATAACAGG + Intergenic
1109225688 13:59692267-59692289 AACATTTGAGGGCTAATAAGAGG + Intronic
1111889679 13:94066535-94066557 AGCATTCAACTGCTAATAAAAGG + Intronic
1114284711 14:21229747-21229769 AACATTAAAATACTAATGACTGG + Intronic
1114472523 14:22973646-22973668 AACACCTGACTCCTAATAACTGG + Intronic
1115173199 14:30531618-30531640 AACATTTAAGTGCAAGTAACAGG - Intergenic
1116040763 14:39684038-39684060 ATCATATAAATGCAAATAACAGG - Intergenic
1116145796 14:41067003-41067025 AACATTTCACTCCTAAGAACAGG - Intergenic
1116462038 14:45188572-45188594 GAAATTTAAGGGCTAATAACAGG - Intronic
1116842953 14:49838107-49838129 AACATTTCACTGCTATTTGCAGG + Intronic
1117089389 14:52235145-52235167 AGCATTTATGTGCTAAAAACTGG + Intergenic
1117099608 14:52333136-52333158 CACATTAAAATGCTACTAACTGG + Intergenic
1120191106 14:81440444-81440466 CACATTTAACTGCTTTTCACAGG - Intergenic
1120281849 14:82449051-82449073 AGCATATAACTGCATATAACAGG + Intergenic
1120466947 14:84870440-84870462 AACATTTAAATGCTAGAAAGAGG - Intergenic
1121126098 14:91407638-91407660 AACGTTTCACTGCTAAGAAAAGG + Intronic
1122834030 14:104422362-104422384 ATCACCTAACTGCTAATAGCTGG + Intergenic
1125028967 15:35057461-35057483 AATATTTAAGTGATAATAATAGG - Intergenic
1128035703 15:64523950-64523972 ACCATTTAACAACTGATAACTGG + Intronic
1133890374 16:9873704-9873726 AACATTTACCTGCTTTTAATAGG - Intronic
1137300110 16:47141602-47141624 AACTTGTAAATGCCAATAACTGG - Intronic
1140632129 16:76866007-76866029 GACATTAAACTCCTAATACCGGG + Intergenic
1143995230 17:11000907-11000929 AACGTTAAACAGCTGATAACTGG - Intergenic
1145046686 17:19623487-19623509 GACATTTATCAGCTAACAACAGG - Intergenic
1146700280 17:34952331-34952353 AAGATCTAACAGCTAGTAACAGG + Intronic
1147047480 17:37764811-37764833 AACATTTAAATTTTAATAAGAGG - Intergenic
1150921413 17:69487638-69487660 AAGTTTTCACTGCTAATGACGGG + Intronic
1150975318 17:70079535-70079557 AACATATAATGTCTAATAACTGG - Intronic
1154316202 18:13305199-13305221 AAGATTTAACTTTTTATAACAGG - Intronic
1157626369 18:49054578-49054600 AACTTGTAACTTCTAATAAGTGG - Intronic
1159251031 18:65876600-65876622 AAGACTTAACTGATGATAACTGG - Intronic
1162665472 19:12207093-12207115 CACATCTTACTGCTAATGACAGG - Intergenic
1167337207 19:48894340-48894362 AACATATAACAGCTATTTACGGG + Intronic
929060716 2:37922106-37922128 AATATTTTACTGCAAATAGCTGG - Intergenic
932066110 2:68562751-68562773 AAGATTGAGCTGCTAATAATTGG + Intronic
934118417 2:88816992-88817014 AACATTTAATTGTTAATTTCTGG - Intergenic
935521463 2:104110482-104110504 AATATTTTATTGCTAAAAACTGG - Intergenic
936418317 2:112340135-112340157 CACATTTAAAAGCTTATAACTGG + Intergenic
939538286 2:143460939-143460961 AACATTTTACTTCAAATAAAAGG - Intronic
939681535 2:145140863-145140885 AATAATTAACTGATGATAACAGG - Intergenic
939742872 2:145931661-145931683 AAACTTTAGCTTCTAATAACTGG + Intergenic
941542414 2:166803413-166803435 AACATTTATCTGTTCATGACAGG + Intergenic
942785671 2:179698734-179698756 AACATTAAACTTCTGATATCTGG - Intronic
945175105 2:207036195-207036217 AACATTTAACCGAAAATAATTGG - Intergenic
945331510 2:208545141-208545163 AACATTTAACTGCTACATCCTGG - Intronic
946738619 2:222779464-222779486 ATAATTTAACTGTTAATAATTGG + Intergenic
947196750 2:227575474-227575496 AACATCTAATTGCTTATCACTGG + Intergenic
947391990 2:229649416-229649438 AACATTTATCTGCATATCACTGG - Intronic
948245243 2:236477213-236477235 AAAACTTAACTACTAATAACTGG + Intronic
1169777319 20:9269921-9269943 AATATTTAAGTGCTTCTAACTGG + Intronic
1170562978 20:17573062-17573084 AACAGGTAACTGCAAAGAACTGG - Intronic
1170967680 20:21090279-21090301 AACATTTAAATCTTAATGACTGG + Intergenic
1172036856 20:32017171-32017193 AACATTTAAGTGCTAACATTAGG + Intronic
1173008776 20:39161797-39161819 AACAATTACATGCTAATAAATGG - Intergenic
1177073988 21:16549200-16549222 AACATTTAACTCTAAATTACTGG + Intergenic
1180013946 21:45070815-45070837 AGCATAAAACTGCTAATAAGAGG - Intergenic
1180094358 21:45549100-45549122 CTCATGTAACTGCTAAAAACTGG + Intergenic
949740346 3:7225917-7225939 AATATTTAACTGTTCACAACTGG - Intronic
950592586 3:13949190-13949212 AACAACAAACTGCTAATACCAGG - Intronic
952046380 3:29326405-29326427 AACCTTTAAATGGTAATAAGAGG - Intronic
959359439 3:105369273-105369295 CACATTTAACTGCTAAAAGGGGG + Intronic
960977801 3:123193133-123193155 AACATTTAAATGATAATTAAAGG - Intronic
963656793 3:148062834-148062856 AGCATACATCTGCTAATAACTGG + Intergenic
964600105 3:158490557-158490579 AAAATTTAACTACTACTAAATGG - Intronic
966090378 3:176128550-176128572 AAATTATAACTACTAATAACTGG + Intergenic
971461704 4:26905906-26905928 TGTATTTAACTGTTAATAACTGG + Intronic
971881329 4:32377714-32377736 AACATTTAACAGCTTATAAAAGG - Intergenic
971972972 4:33644506-33644528 TACATTTATTTACTAATAACAGG + Intergenic
973577941 4:52311288-52311310 AATATTTAACTGTTACAAACTGG - Intergenic
974448477 4:62018000-62018022 AGCATTTTAATGCTAATAAGAGG + Intronic
974884571 4:67802826-67802848 AACATTTAGCTGCTAAGGAAGGG - Intergenic
976931552 4:90572343-90572365 AACATTTAACTTCTTGTACCTGG + Intronic
977018121 4:91720223-91720245 AACTCTTAACTTCTAATAAAAGG - Intergenic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
978048616 4:104166916-104166938 AATAATTAACTACTAAAAACTGG + Intergenic
978660306 4:111118590-111118612 TACATTTACCAGATAATAACTGG + Intergenic
980488672 4:133495475-133495497 GACATTAAACTGAGAATAACTGG - Intergenic
980836852 4:138204841-138204863 ACCTTTTAACTACTAATAATTGG + Intronic
981013118 4:139946526-139946548 AACGTATAACTGCTAATTATGGG + Intronic
981717773 4:147768702-147768724 AACATTTAAGTGCTTAAAAATGG + Intronic
981852910 4:149252368-149252390 GACATTTAGGTGCTCATAACTGG + Intergenic
983847561 4:172538728-172538750 AACATTTTACTTCTAAGAATGGG + Intronic
987576887 5:19740188-19740210 AGCATTTAACAGGTAGTAACAGG - Intronic
989622836 5:43401618-43401640 TACATTTAAGTGCTTAGAACAGG + Intronic
993586043 5:89729586-89729608 AACATTTTTATGTTAATAACAGG - Intergenic
994601969 5:101917621-101917643 AAATTTTAAATACTAATAACAGG - Intergenic
994699686 5:103118693-103118715 AAAGTTTTACTGCTAATAATTGG + Intronic
994879828 5:105475779-105475801 AAAATTTAAGTCCTAATTACTGG - Intergenic
995024797 5:107407631-107407653 AACATTTAATTCCTAAAAATTGG - Intronic
995906841 5:117134999-117135021 AACATTTTGCTGCTGATAATAGG + Intergenic
998591144 5:143479526-143479548 AAAGTCTAACTGCTAATAAGTGG + Intergenic
999528275 5:152432573-152432595 AAGATTTTACAGCTAATAAGGGG - Intronic
999793688 5:154967652-154967674 AACAATTTTCTGCTAATAAAAGG - Exonic
1000434589 5:161192602-161192624 AGCACTTAACTGCTAATAGTTGG + Intergenic
1001344467 5:170879049-170879071 AACATTTTTCTATTAATAACTGG + Intronic
1004132612 6:12934868-12934890 AGCACTTACCAGCTAATAACCGG + Intronic
1004151390 6:13123457-13123479 AACATTTAAAGGCTTATAATGGG + Intronic
1004757399 6:18627370-18627392 ATCATTTAACTGTAAATAAGTGG - Intergenic
1005404625 6:25473364-25473386 AAAACTTAACTACTAATAGCAGG + Intronic
1009588256 6:65634651-65634673 AACATTAAATTGCTATTAACTGG - Intronic
1012077241 6:94704663-94704685 AACATTTAATTACTAATATTGGG - Intergenic
1014040956 6:116824461-116824483 AACAATTATATGCTAATAAATGG + Intronic
1014943866 6:127474892-127474914 AATATTTAACTGCTGATATGTGG - Intronic
1016179948 6:141133385-141133407 AAGATTTAACTCCTAATCAGGGG + Intergenic
1017788619 6:157776192-157776214 GGAATTTAACTGCTAATAATTGG + Intronic
1018200420 6:161389612-161389634 AACATTTATCTGTTAATACTTGG + Intronic
1018671226 6:166179158-166179180 AATTGTTAACTGTTAATAACTGG - Intergenic
1019019365 6:168904638-168904660 AACAGTTAACCGCTAAGAAAAGG - Intergenic
1020419531 7:7985798-7985820 AAAATTAAACTGCAGATAACAGG - Intronic
1021339293 7:19443422-19443444 AACATTAAACGCCTAATAAAGGG + Intergenic
1025073546 7:55922681-55922703 AACATTCAATTGCTAAAAAATGG - Intronic
1025849580 7:65235171-65235193 AACATTTAAGTGTTAATTAATGG + Intergenic
1026331718 7:69357918-69357940 AACATTTGGTGGCTAATAACAGG - Intergenic
1026805516 7:73427261-73427283 CACATTAAAATGTTAATAACTGG - Intergenic
1027547563 7:79547720-79547742 AACACTTAGCTGATACTAACTGG + Intergenic
1027804856 7:82805605-82805627 AACAGTTAACAGGAAATAACTGG - Intronic
1027962265 7:84961004-84961026 AACTTTTAACTGCTCATCATAGG - Intergenic
1028708274 7:93876055-93876077 AACATTTAACTGCTAATAACAGG - Intronic
1030659338 7:112204126-112204148 AACATTTGACTGATAATATCCGG + Intronic
1031252558 7:119406158-119406180 AACATTAAAGTCTTAATAACAGG + Intergenic
1031643991 7:124201268-124201290 CACATATATCTGCTAATTACAGG + Intergenic
1031944238 7:127822067-127822089 AAAATTCAAATGCTAATAAAGGG + Intronic
1032621501 7:133538328-133538350 ACCATTTAACAGCAAATAAAGGG - Intronic
1032801887 7:135323434-135323456 AACATTTAAAAGTGAATAACTGG + Intergenic
1036129310 8:6093723-6093745 AACATTTAACAGGGAATAAATGG - Intergenic
1036666607 8:10748010-10748032 AACAATTAACTGGAAATAAAAGG - Intronic
1037217981 8:16481190-16481212 AACATGTAAATGGAAATAACTGG - Intronic
1038151775 8:24948067-24948089 AACATATAAATGAAAATAACTGG + Intergenic
1039031492 8:33314450-33314472 ATGATTTCACAGCTAATAACTGG - Intergenic
1040903430 8:52440198-52440220 AATATTTACATGCTAATAATAGG + Intronic
1042248497 8:66731832-66731854 TACATTTAAATGTTAATACCCGG - Intronic
1042711796 8:71725696-71725718 ATTATTTAAATGCTTATAACTGG + Intergenic
1042842965 8:73142945-73142967 ATCACTTGGCTGCTAATAACTGG + Intergenic
1043687234 8:83102155-83102177 AACATTTTTCTTCTAAGAACTGG - Intergenic
1044434790 8:92149135-92149157 AACTTTTATCTGCAAATTACAGG - Intergenic
1044474515 8:92610541-92610563 TATATTTTAGTGCTAATAACAGG - Intergenic
1045903040 8:107307962-107307984 AATTTTTAACTGATAAAAACTGG - Intronic
1045960092 8:107957141-107957163 AATATATAACTGCTTAAAACAGG - Intronic
1046544090 8:115625398-115625420 AAAATTGAAGTGCTATTAACCGG - Intronic
1046959242 8:120092954-120092976 AAAATTTAAAAGCTAATATCAGG + Intronic
1047299695 8:123602579-123602601 AACATTTAACTCCTTATTAGGGG + Intergenic
1048950728 8:139494828-139494850 GACATTTAACTCCTCAAAACGGG + Intergenic
1050014113 9:1215203-1215225 AAAACTTAACTACTAATAACTGG + Intergenic
1050229613 9:3507495-3507517 AACATTAAACTGCTAGTCAGTGG + Intronic
1050708279 9:8429217-8429239 AACATTTAAGTGTTTATATCAGG + Intronic
1056410901 9:86325788-86325810 AATTTTGAACTGTTAATAACAGG + Intronic
1057712891 9:97463116-97463138 TACATTTAAATGATAATACCTGG + Intronic
1058059777 9:100482754-100482776 AACATATAATTGTGAATAACAGG - Intronic
1186920060 X:14268979-14269001 ACCAATCAACTGCTAATAAACGG - Intergenic
1188156866 X:26751061-26751083 AACATTTAACTATTAATTAAAGG + Intergenic
1188571937 X:31597787-31597809 ATCATTTTATTTCTAATAACTGG + Intronic
1188577690 X:31672481-31672503 AACATCTCACTTTTAATAACAGG - Intronic
1188722512 X:33540868-33540890 AAAATTTAACTTCTAACAATGGG + Intergenic
1188767458 X:34113204-34113226 ACTATTTAACTGCTAACAACTGG + Intergenic
1192247405 X:69385164-69385186 AACATTTTTCTGCTAATGTCAGG - Intergenic
1193638268 X:83980083-83980105 AACAATTAACTCCAAATAAATGG + Intergenic
1193845458 X:86464774-86464796 AACTTTCAGCTGCTAAAAACAGG + Intronic
1194744736 X:97615968-97615990 ACCATTTGACTGCTACTATCTGG + Intergenic
1195158992 X:102153321-102153343 AACATGTACCTGATAATTACAGG - Intergenic
1196263264 X:113610848-113610870 GACATTAAAATGCTAATAAAGGG - Intergenic
1196358641 X:114825797-114825819 AACATTTAAAATATAATAACAGG - Intronic
1197232194 X:124017018-124017040 AATATTCAACTGCTAAAAGCTGG - Intronic
1200281261 X:154778901-154778923 AAAATGTAACTGCTAATCAAGGG - Exonic
1201355294 Y:13091166-13091188 AACATTTAATTGCTCAAAAAAGG + Intergenic
1201601486 Y:15733442-15733464 AGCAATTATGTGCTAATAACAGG + Intergenic