ID: 1028713368

View in Genome Browser
Species Human (GRCh38)
Location 7:93936489-93936511
Sequence AGGTTTTCAATGATGGAATA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028713365_1028713368 -10 Left 1028713365 7:93936476-93936498 CCCTGGGTCATACAGGTTTTCAA No data
Right 1028713368 7:93936489-93936511 AGGTTTTCAATGATGGAATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028713368 Original CRISPR AGGTTTTCAATGATGGAATA CGG Intergenic
No off target data available for this crispr