ID: 1028715906

View in Genome Browser
Species Human (GRCh38)
Location 7:93968009-93968031
Sequence TATTACGTTAAGAAAATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 215}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028715906_1028715908 12 Left 1028715906 7:93968009-93968031 CCTTCCATTTTCTTAACGTAATA 0: 1
1: 0
2: 1
3: 11
4: 215
Right 1028715908 7:93968044-93968066 AATTCACAAACATTTCAATTTGG 0: 1
1: 0
2: 4
3: 35
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028715906 Original CRISPR TATTACGTTAAGAAAATGGA AGG (reversed) Intronic
902682766 1:18055339-18055361 TATTACCTTATGGAAATAGACGG + Intergenic
903987810 1:27241748-27241770 AATTACCTTAAGATAGTGGAAGG - Intronic
906010432 1:42519322-42519344 TGTTCCTTTAAGAAAATGAAGGG - Intronic
906019681 1:42616430-42616452 TATTTAGGAAAGAAAATGGAAGG + Intronic
906036435 1:42753100-42753122 TATAATGTTAAGAACAAGGAAGG + Intronic
906038804 1:42770320-42770342 TAACACCTTAAGAAAAGGGAGGG + Intronic
907226527 1:52952344-52952366 TATCACATTAAAAAAATAGATGG + Intronic
907736134 1:57114281-57114303 TTTTAAGGAAAGAAAATGGAAGG + Intronic
907744442 1:57198842-57198864 TAGCACATTAGGAAAATGGAAGG + Intronic
907857659 1:58319578-58319600 TATTACCTTGAGAAAAAGTATGG + Intronic
911512457 1:98824294-98824316 TATAACTTTAAGAAAAAGAAGGG - Intergenic
912091066 1:106077217-106077239 TATTATTTCAAGGAAATGGATGG - Intergenic
915781555 1:158556617-158556639 TATTATGTCAAGCAAATAGAAGG + Intergenic
918569895 1:185977558-185977580 TATCACCTTAAGGAAATGGTTGG + Intronic
919697520 1:200593655-200593677 TATTACGTCATGTAAGTGGATGG - Exonic
1066232120 10:33445974-33445996 AATTTCCTTTAGAAAATGGAAGG + Intergenic
1067981563 10:51092311-51092333 GATTTCGTGAAGAAAGTGGAGGG + Intronic
1068106714 10:52627113-52627135 TCTTACCTGAAAAAAATGGATGG - Intergenic
1068131804 10:52904699-52904721 TATATCGTTGAGAAGATGGAGGG + Intergenic
1069395885 10:67987287-67987309 TTTTACCTCGAGAAAATGGAAGG - Intronic
1070442123 10:76456560-76456582 AACTACCTTATGAAAATGGAAGG - Intronic
1073497565 10:103907743-103907765 TTTTGCGTTAAAAAAATGCATGG + Intronic
1073744788 10:106455401-106455423 ATTTGCCTTAAGAAAATGGAAGG - Intergenic
1074665655 10:115720226-115720248 TTTGAAGTCAAGAAAATGGAAGG - Intronic
1074832499 10:117259242-117259264 TAAAACATTAAGAAAATGAAAGG - Intronic
1075130584 10:119735312-119735334 TATCAAGTTAAAAAAATGCAAGG - Intronic
1075756562 10:124816760-124816782 TGTTAGGTTAGGAAAAGGGAAGG + Intronic
1075884633 10:125887813-125887835 AATGACTTTAAGAAAATTGAAGG - Intronic
1079711967 11:23695839-23695861 TATTACATTAACAAGATAGAAGG + Intergenic
1079774928 11:24513113-24513135 TATTATTTTAAGAAAATAGATGG + Intronic
1079866048 11:25735544-25735566 AATTACAATAAAAAAATGGAAGG - Intergenic
1079892500 11:26074396-26074418 GATCAAGTTAAAAAAATGGAGGG + Intergenic
1079993127 11:27267275-27267297 TAATACATTTAGAAAATGGTAGG + Intergenic
1080593588 11:33747205-33747227 TTTAAAGTAAAGAAAATGGAAGG + Exonic
1081090155 11:38854778-38854800 GATGACATTAAGAAAGTGGAAGG - Intergenic
1083138580 11:60703113-60703135 TATTAAGTTAATAAAATTCAGGG + Intronic
1086030392 11:82347889-82347911 TAATAGGTGAAGAAAATGGATGG - Intergenic
1087148964 11:94841133-94841155 TTTTATGTTAAGAAAAGAGAAGG + Intronic
1090591759 11:128278777-128278799 GATTACGTTAAAAAAATGGAGGG - Intergenic
1091495509 12:968986-969008 TATTTGGACAAGAAAATGGATGG + Intronic
1098064240 12:66595326-66595348 TATGACTTTAAGAAAAAGGAAGG + Intronic
1098786280 12:74760586-74760608 TATTATTTTAAAAAAATTGAAGG - Intergenic
1099137550 12:78926998-78927020 TATTACTTTAAGAAAATTCTGGG - Intronic
1099447882 12:82773822-82773844 TAAAAGGTTAAGAAAATGGTTGG - Intronic
1099776414 12:87137280-87137302 TATTACCTTTAGAAAAAGAAAGG + Intergenic
1101411472 12:104472271-104472293 CATCCCCTTAAGAAAATGGAAGG - Intronic
1104261587 12:127188136-127188158 AATTAAGTTCAGAAAATGTACGG + Intergenic
1106577202 13:30986472-30986494 TTTTAGGTTAAGAAACTAGAGGG - Intergenic
1106818979 13:33441986-33442008 TATTAGTTTAAAAATATGGAGGG - Intergenic
1107052688 13:36068733-36068755 GATTGCTTTAAGAAAATGCAGGG + Intronic
1109358437 13:61264925-61264947 AATTATGTTACGAAAATTGAAGG - Intergenic
1109587145 13:64421107-64421129 TATTACTTGAAAAAACTGGATGG + Intergenic
1109898968 13:68737619-68737641 TATTACGTCCAGAAAATAGTGGG - Intergenic
1110982122 13:81913723-81913745 TTTTACGATAAGAAAATTAATGG - Intergenic
1111877120 13:93911298-93911320 CTATACCTTAAGAAAATGGAAGG + Intronic
1113326985 13:109291926-109291948 AATTACTTTAGGATAATGGAAGG + Intergenic
1114067905 14:19080987-19081009 TATCACATTAACAAAATGAAAGG + Intergenic
1114372201 14:22102223-22102245 TATTACGTTAAGAAACTTACAGG - Intergenic
1114962122 14:27905589-27905611 TATCACTTTAAGAAACTGGCAGG - Intergenic
1115149995 14:30273410-30273432 TATTACATTAAGATACTGAAAGG + Intergenic
1119337419 14:73845509-73845531 AAGTACCTTAAGAAAATGAAAGG - Intergenic
1120266092 14:82252562-82252584 TATTAAGTTATGAAAGTGGGTGG + Intergenic
1120871640 14:89342607-89342629 TATTTTGTTAAAAAATTGGAGGG - Intronic
1202873379 14_GL000225v1_random:186086-186108 AATGACTTTAAGAAAATTGAAGG + Intergenic
1125237117 15:37528361-37528383 TCTTAGATCAAGAAAATGGATGG - Intergenic
1125750740 15:42026224-42026246 TATTATGGGAACAAAATGGAGGG + Intronic
1125982525 15:44015871-44015893 TATTATTTTAAGTAAATGAAAGG + Intronic
1127139343 15:55958522-55958544 AAACACGTTCAGAAAATGGAGGG - Intronic
1128587694 15:68864822-68864844 TATTACTTAAAGACACTGGAAGG + Intronic
1130832647 15:87617049-87617071 TGTGACGTTCAGACAATGGAGGG - Intergenic
1131522957 15:93130132-93130154 TAATACAGCAAGAAAATGGAGGG - Intergenic
1131911352 15:97207991-97208013 TTTGTCCTTAAGAAAATGGAAGG + Intergenic
1132953844 16:2580536-2580558 TAATACGATACAAAAATGGAAGG - Intronic
1132960501 16:2619627-2619649 TAATACGATACAAAAATGGAAGG + Intergenic
1135695063 16:24578613-24578635 TATGACATAAAGAAAATGCAGGG - Intergenic
1135755495 16:25093896-25093918 TATGACTTTAACTAAATGGATGG + Intergenic
1135927007 16:26704031-26704053 TCTTACCTTAAGAAGCTGGAAGG + Intergenic
1136957969 16:34805823-34805845 TCTGAGGTTAAAAAAATGGAAGG - Intergenic
1137340476 16:47597827-47597849 AATTAGGTTAAGAAAATTAAAGG + Intronic
1138663295 16:58539731-58539753 TATTACTTTTAGAAAATGCTAGG - Intronic
1138863548 16:60789409-60789431 TACTAAGTTAAAAAAAAGGAAGG - Intergenic
1142258189 16:89025812-89025834 TATTACGTTAAGCTCCTGGAGGG + Intergenic
1144217248 17:13067477-13067499 TATTATATTAAAAAAATGTAAGG + Intergenic
1144459312 17:15445241-15445263 TATTACTTAAAGAAAAAGAAGGG + Intronic
1147947618 17:44088847-44088869 TATTCAGTTAAGGAAATCGAAGG - Intronic
1150854447 17:68737610-68737632 TTGTAGGTTAAGAAAAAGGATGG - Intergenic
1151041283 17:70863385-70863407 TCTTTCTTTAAAAAAATGGAAGG - Intergenic
1151742214 17:75991237-75991259 TATGCCATTAAGAAAATTGAAGG + Intronic
1152305344 17:79517143-79517165 TATCACAATAAGAAAAAGGAGGG + Intergenic
1152487702 17:80605358-80605380 TTTTACATTAAGAAAAAAGAAGG + Intronic
1153026798 18:679842-679864 TATTACCCTAAGCAAAGGGAAGG - Intronic
1155673119 18:28396080-28396102 TAATGCTTTAAGAAAATGGTGGG + Intergenic
1156091141 18:33471328-33471350 GATTATGTTGAGAAAATTGAGGG - Intergenic
1159636336 18:70809477-70809499 TTTAACTTTAAGAAAATGAAAGG + Intergenic
1159971893 18:74665617-74665639 CATTACATTAAGAAGATGGCAGG - Intronic
1160094135 18:75855160-75855182 GATTAAGGTAAGAAAATGGGAGG + Intergenic
1160263417 18:77316964-77316986 TTTTACATTAAGAAGATGGCAGG - Intergenic
1160611553 18:80091640-80091662 TATCCTGTTAATAAAATGGAGGG + Intronic
925948375 2:8887911-8887933 TATTAGAGTAAGGAAATGGAGGG - Intronic
927081130 2:19631669-19631691 TATTACTTTAAAAAATTTGATGG - Intergenic
927745330 2:25614653-25614675 TACTATGTTCATAAAATGGAAGG + Intronic
931644692 2:64411346-64411368 TGTTTCCTTGAGAAAATGGAAGG + Intergenic
931914777 2:66942148-66942170 CTTTTCGTTAAGAATATGGATGG + Intergenic
933573761 2:84043706-84043728 TTTTACATTTAGAAAATGGAAGG + Intergenic
937169638 2:119852735-119852757 TGTTACATTAAAAAAAGGGAAGG - Intronic
937565881 2:123288130-123288152 TATTAAGTTAAAATCATGGATGG + Intergenic
940087559 2:149877862-149877884 TATTAATTTAAGAAAGTGGAAGG + Intergenic
940890672 2:159032655-159032677 TTGTAAGTTAAGAGAATGGAGGG - Intronic
941085871 2:161117514-161117536 TATTTCTTTAAAAAAATTGAGGG - Intergenic
942330507 2:174818666-174818688 TATTAACTTGAGAAATTGGAAGG - Intronic
942381632 2:175397835-175397857 TGTTTCATTTAGAAAATGGAAGG - Intergenic
945048891 2:205805341-205805363 TGTTACATTAACAAGATGGAAGG + Intergenic
945317430 2:208385058-208385080 CTGTACTTTAAGAAAATGGATGG + Intronic
945905642 2:215589685-215589707 TAACACATCAAGAAAATGGAGGG - Intergenic
947012920 2:225585646-225585668 TTTTACTTTACGTAAATGGAAGG + Intronic
947376178 2:229498147-229498169 TATTACTTTAAAAGAATGAAGGG + Intronic
1169520676 20:6369605-6369627 TATTATGCAAAGAAAATGCAGGG - Intergenic
1169529527 20:6469542-6469564 TATTACATTCTGAAAATGAATGG + Intergenic
1170165217 20:13355045-13355067 TATAATGTTAGGAAAATAGAGGG + Intergenic
1170452779 20:16502771-16502793 TATTAGGTTAAAAGAATGAAGGG - Intronic
1170995369 20:21350634-21350656 TATTACCCTAGGAAAATGTATGG - Intronic
1172246905 20:33451745-33451767 TATTGCTTTAAGAAAAAGGCTGG - Intergenic
1174642635 20:52057715-52057737 TATCAAGTTTAGAACATGGAAGG - Intronic
1175060143 20:56234445-56234467 TATGATGAGAAGAAAATGGAAGG - Intergenic
1176982213 21:15396411-15396433 AATAAATTTAAGAAAATGGATGG + Intergenic
1177300327 21:19236051-19236073 TTTTTCTGTAAGAAAATGGATGG - Intergenic
1177632444 21:23745399-23745421 TGTTGTGATAAGAAAATGGATGG - Intergenic
1177742653 21:25172665-25172687 TATCACGTTAATAAACTGAAAGG + Intergenic
1178049934 21:28736226-28736248 TATTAGGATGAGAATATGGAAGG + Intergenic
1178266644 21:31148620-31148642 TATTAAGTTAAATAAATGAATGG - Intronic
1178559536 21:33625783-33625805 TATAGCGTTAAGAAAATTTAAGG - Intronic
1180284712 22:10733434-10733456 AATGACTTTAAGAAAATTGAAGG - Intergenic
1182991039 22:34768031-34768053 TATTATTTTCAGAAAATGGAAGG + Intergenic
950826163 3:15823782-15823804 TATCACATTAATAAAATGAAAGG + Intronic
950910932 3:16591057-16591079 TATTACGGTTAGTAAAGGGAAGG - Intronic
953121525 3:40047432-40047454 TTTTATTTTAAGAAAGTGGAGGG + Intronic
953818819 3:46186202-46186224 GATACCATTAAGAAAATGGAAGG - Intronic
955992645 3:64644255-64644277 TTTTACGAAAAGAAAATGAAGGG + Intronic
956072438 3:65467793-65467815 AATTACGCTGAGAAAAGGGAAGG - Intronic
956258177 3:67306946-67306968 TATAACTTTAAGAAAAGTGATGG - Intergenic
957764083 3:84598775-84598797 AATTAGGTTATAAAAATGGAAGG - Intergenic
958083514 3:88776918-88776940 AATTACTTTTACAAAATGGAAGG + Intergenic
963439879 3:145325500-145325522 TATCATGTTAATAAAATGAAAGG + Intergenic
964389441 3:156182555-156182577 GATTTTCTTAAGAAAATGGAAGG - Intronic
964945502 3:162218804-162218826 AATTACGTAAAGAAAATGACAGG - Intergenic
965551347 3:169967435-169967457 TATTAAGTTAATAATATTGAAGG - Intronic
965878903 3:173364444-173364466 TATTACATTAATCAAATTGATGG - Intergenic
967351765 3:188521695-188521717 GATTTAGATAAGAAAATGGATGG - Intronic
971023766 4:22567320-22567342 GATAACGTTAAGAAAATAAAAGG + Intergenic
971956609 4:33428171-33428193 TAGAAAGTCAAGAAAATGGAGGG - Intergenic
972482982 4:39515531-39515553 ATTTATGTTAAGAATATGGAGGG + Intronic
974900620 4:67992717-67992739 AAGTATGTCAAGAAAATGGAAGG - Intergenic
974919040 4:68214254-68214276 TATTCCACTGAGAAAATGGAAGG + Intergenic
975178529 4:71315422-71315444 TATTATGATAAGAAACTGAAAGG + Intronic
976615486 4:87071698-87071720 AATTGCCTTTAGAAAATGGAGGG - Intronic
977412569 4:96686832-96686854 TTATAAGTTAAGAAAATGAAAGG + Intergenic
978702806 4:111669817-111669839 TATTAGGTTAGTAAAATGCAAGG - Intergenic
979561036 4:122102494-122102516 TATTATGTTAAGACATTGGGTGG - Intergenic
980342824 4:131572557-131572579 CTTTACATTAAGAAAATGGGTGG + Intergenic
984402464 4:179284706-179284728 GCTTACGTTTAGAAATTGGAAGG + Intergenic
989280094 5:39631333-39631355 TATACCATTAAGAAAATGAAAGG + Intergenic
990530939 5:56673055-56673077 TATTACGTGAATGAAATGAATGG - Intergenic
992877736 5:81074480-81074502 TATTACGTATAGAAAGTGGGGGG - Intronic
993326300 5:86542208-86542230 TTTTACATAAAGAAATTGGAGGG - Intergenic
993788362 5:92173578-92173600 TATCATGTTAATAAAATGAAAGG + Intergenic
994163051 5:96578995-96579017 TATTGCTTGAAGAAAGTGGAAGG + Intronic
994996172 5:107066084-107066106 TATTAACTGAAGAAAATGGAAGG + Intergenic
995655988 5:114426526-114426548 AAATACTTTAAAAAAATGGAAGG - Intronic
995660030 5:114471437-114471459 TATTTCAGTAAAAAAATGGATGG - Intronic
996105657 5:119499340-119499362 TATAAGCATAAGAAAATGGAGGG - Exonic
997125502 5:131223016-131223038 TGCTATTTTAAGAAAATGGATGG - Intergenic
998612113 5:143700523-143700545 TATTATGCTAAGCAAATGGTGGG - Intergenic
1003601875 6:7525222-7525244 TAATGAGTTAAGAAAATGCAAGG + Intergenic
1004978902 6:21000210-21000232 CATTTCCTTAAAAAAATGGAAGG - Exonic
1005377982 6:25203688-25203710 TATTTCTTTAAGAGGATGGATGG + Intergenic
1009479485 6:64139146-64139168 TAATACTATAAGAAAATGTATGG + Intronic
1011140923 6:84155494-84155516 TAATAGGTTAAGGAAATGGAAGG - Exonic
1011417139 6:87133666-87133688 TATTTCTTTAACAAAATGAAGGG + Intergenic
1014287837 6:119521664-119521686 TACTAAGATAACAAAATGGAAGG - Intergenic
1016283977 6:142451945-142451967 TATTAGGTTATGAAAAGGCATGG - Intergenic
1021019523 7:15579345-15579367 TATTACTTTCTGCAAATGGATGG - Intergenic
1023497027 7:40808557-40808579 TATTAGGTTTGGACAATGGAAGG - Intronic
1024625638 7:51207248-51207270 TTTTTGGTTAAGGAAATGGAAGG + Intronic
1024961453 7:54981165-54981187 TATTAGGTCCAGGAAATGGATGG - Intergenic
1028715906 7:93968009-93968031 TATTACGTTAAGAAAATGGAAGG - Intronic
1028881289 7:95882842-95882864 TATTTGGGTAAGAAAATGAAAGG + Intronic
1031241262 7:119243412-119243434 TATCAAGTAAAAAAAATGGATGG - Intergenic
1031322790 7:120354113-120354135 TATTGCATTAAAAAAATGGCTGG - Intronic
1033377888 7:140781359-140781381 TATTACTGTAATAAAATGGTAGG + Intronic
1033756112 7:144399204-144399226 TATAACGGTAAGGAAATGGGAGG + Intronic
1034172967 7:149077325-149077347 TATTAGATTAAGAAGATGGGTGG + Intronic
1034605003 7:152304143-152304165 TTTTAATCTAAGAAAATGGAAGG - Intronic
1037358876 8:18052636-18052658 AAACACGTTAAGAAAATGGCCGG - Intergenic
1037372681 8:18196766-18196788 TATTATTTTAAGAAAGAGGAAGG + Intronic
1040776716 8:51052734-51052756 CATGATGTTAAGATAATGGAAGG - Intergenic
1040891459 8:52321271-52321293 TATTTCCTTAAGAAATTGAATGG - Intronic
1041320321 8:56605710-56605732 TATTCATTTAAGTAAATGGAAGG + Intergenic
1042500482 8:69503191-69503213 TATTACGTGAAGAAAGTGAATGG + Intronic
1043117236 8:76273109-76273131 AATTACTTTAACAAAATGAAGGG + Intergenic
1043618277 8:82155295-82155317 TATTATCTTATGAAAATGCAAGG + Intergenic
1044793151 8:95868531-95868553 TATACAGTTAAGTAAATGGATGG - Intergenic
1047070952 8:121342969-121342991 AATTACTTTAGGAAAATGGAGGG - Intergenic
1048475298 8:134737347-134737369 TATTACCTTATGAAAATAAATGG + Intergenic
1049950324 9:637329-637351 TACTTTGTTTAGAAAATGGAGGG + Intronic
1050989149 9:12125082-12125104 TTTTATCTTAAGCAAATGGATGG + Intergenic
1052657457 9:31381101-31381123 TATAAAGAAAAGAAAATGGATGG - Intergenic
1053191246 9:36071429-36071451 CATTATGTTAAGAGAATGGCAGG - Intronic
1053897862 9:42762709-42762731 TGTTAGGTTAACAAAATGCAAGG + Intergenic
1055200287 9:73650217-73650239 AAGTACTTTAAGAAAATAGAGGG + Intergenic
1055520764 9:77078920-77078942 TATAACCTCAAGAAAATGGCAGG + Intergenic
1058230868 9:102422520-102422542 GATTAATTTAAGAAAATGTAGGG + Intergenic
1058287717 9:103201074-103201096 TATTACTTTTGGAAAATGAAAGG + Intergenic
1058292523 9:103259602-103259624 TATTATTTTAAGAAAATGAGTGG - Intergenic
1058315665 9:103562139-103562161 TAGTACTCTAAGATAATGGAGGG + Intergenic
1058326676 9:103707149-103707171 TTTTATGTTAAGTACATGGAGGG - Intergenic
1058370685 9:104263555-104263577 TATATTGTTAAGAAAATAGATGG - Intergenic
1058713299 9:107700037-107700059 CATTATGATAAGACAATGGAAGG + Intergenic
1059044624 9:110853011-110853033 TATTTTGATGAGAAAATGGAGGG - Intergenic
1203731080 Un_GL000216v2:90452-90474 AATGACTTTAAGAAAATTGAAGG - Intergenic
1190437652 X:50442221-50442243 TATTCCATTCAGAAAATAGATGG - Intronic
1194148787 X:90297442-90297464 TATTACTTTAAGAATATTAAAGG - Intergenic
1194202414 X:90970185-90970207 TATTACATTAAGAAACTCTAAGG + Intergenic
1194916268 X:99713002-99713024 TATTACTTTAAGAAGGTGGTAGG + Intergenic
1197417924 X:126198089-126198111 TATTTCCTGAAGAAAAAGGAAGG - Intergenic
1198510218 X:137342859-137342881 TATTAGGATAAGAAACTGGAAGG - Intergenic
1199688144 X:150282567-150282589 TATGACTTTAATAAAATGTAGGG + Intergenic
1200495156 Y:3874174-3874196 TATTACTTTAAGAATATTAAAGG - Intergenic
1200548250 Y:4545645-4545667 TATTACATTAAGAAACTCTAAGG + Intergenic