ID: 1028715998

View in Genome Browser
Species Human (GRCh38)
Location 7:93969495-93969517
Sequence GTGGATATGAATAATCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028715996_1028715998 -9 Left 1028715996 7:93969481-93969503 CCTACTCTATGCTGGTGGATATG 0: 1
1: 0
2: 0
3: 23
4: 403
Right 1028715998 7:93969495-93969517 GTGGATATGAATAATCAGGAAGG 0: 1
1: 0
2: 3
3: 17
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028715998 Original CRISPR GTGGATATGAATAATCAGGA AGG Intronic
902136590 1:14311509-14311531 GTGGGGTGGAATAATCAGGACGG + Intergenic
904346817 1:29878165-29878187 GTGGATTTGGAAAATCAGGAGGG - Intergenic
905585246 1:39112068-39112090 AAAGATTTGAATAATCAGGAAGG - Intronic
905636551 1:39557701-39557723 GTGTATAGTAAGAATCAGGAGGG - Intergenic
906297478 1:44658097-44658119 ATGGATATGAAAACCCAGGAAGG - Intronic
908897409 1:68915863-68915885 GAAGATCTGAATATTCAGGAAGG - Intergenic
910215733 1:84842292-84842314 GTGGTTATGACTTATCTGGAAGG - Intronic
913397694 1:118390186-118390208 GTGGATGTGAATCATCATAAAGG - Intergenic
913412021 1:118562601-118562623 TTGGATATGAATAAGGGGGAGGG + Intergenic
914460328 1:147877868-147877890 GAGGATATGAAAAGTGAGGAAGG + Intergenic
919172452 1:193972499-193972521 GTGGAAGTGAATCATCAGCAAGG - Intergenic
920213047 1:204342524-204342546 GTGCATATGAATCACCTGGAGGG + Intronic
921233120 1:213093996-213094018 GATGAGATGAATAACCAGGAAGG - Intronic
921603316 1:217130547-217130569 GTGGAGATGTAACATCAGGAAGG - Intronic
1063336335 10:5218727-5218749 CTGAAAATGGATAATCAGGATGG - Exonic
1065885992 10:30077514-30077536 CTGGAAATGAATAGTCATGATGG - Intronic
1068328602 10:55530273-55530295 ATGGATAAGAATAATAATGATGG - Intronic
1068343847 10:55744688-55744710 GTGCATATAACTAATGAGGAGGG + Intergenic
1068663975 10:59653117-59653139 TTGGATAAGAATAAGCAGGCAGG + Intronic
1069346267 10:67473972-67473994 GTAAATATTAATAATTAGGAAGG + Intronic
1071834297 10:89404518-89404540 GGGGCTATGAATATTCATGAGGG - Intronic
1074733017 10:116397703-116397725 GTGGAGATTTATAATGAGGAAGG + Intergenic
1074856616 10:117478851-117478873 GAGGATAAGAATCGTCAGGAAGG - Intergenic
1076397013 10:130146617-130146639 TTAGAAATGAATTATCAGGAGGG + Intronic
1076638382 10:131898263-131898285 GGAGCTATGAATACTCAGGAAGG - Intergenic
1079646140 11:22865806-22865828 GTGGTTATGAATTTTCAGAAGGG + Intergenic
1081209008 11:40308903-40308925 ATGCATATGAATCATCAGAATGG + Intronic
1082713109 11:56578642-56578664 GTGTACATGAATAAACAGGCAGG - Intergenic
1083580113 11:63819161-63819183 GGGGATCTGAATGATGAGGAAGG + Intronic
1085235098 11:75008483-75008505 GTGGATAGGAATAGGGAGGATGG + Exonic
1085255742 11:75171834-75171856 GGGGATATTAATCATCATGAAGG + Intronic
1085692688 11:78676546-78676568 TTGGATATGGAGAATCTGGATGG - Intronic
1086941884 11:92806854-92806876 GGGGAAATGAATAATCTGGAGGG + Intronic
1086957948 11:92953409-92953431 GTGGATATGGATCATCATAAAGG + Intergenic
1087889966 11:103526812-103526834 TTGGATATAAAAAATCAAGAGGG - Intergenic
1089947373 11:122490869-122490891 GTGCATAAGAATCATCTGGAGGG + Intergenic
1090931111 11:131298955-131298977 GTGGACCAGAATAATCTGGAAGG + Intergenic
1091139006 11:133219523-133219545 ATGGATAAGAATCATCCGGAGGG + Intronic
1091810285 12:3391313-3391335 GTAGATATGAAGGATCAGGGAGG + Intronic
1092318360 12:7443381-7443403 GTGGAAATAAAGAATCACGAAGG - Intronic
1092480982 12:8858757-8858779 GTGTATCAGAATAATCAGGAGGG - Intronic
1092736788 12:11590339-11590361 TTGCTTATGAATAAACAGGAAGG + Intergenic
1095236513 12:39802799-39802821 GTGGTTATAAATTCTCAGGATGG - Intronic
1097879886 12:64677120-64677142 GTGTAAATGAAGAATGAGGAAGG - Intronic
1099228757 12:79999438-79999460 GTGGAGTTGAATATTCAGTAGGG + Intergenic
1099271750 12:80519611-80519633 GGAGCTATGAATATTCAGGAAGG + Intronic
1100144157 12:91656774-91656796 GTGGAAATGAATCATCATAAAGG - Intergenic
1100645302 12:96523032-96523054 GGGGATATTAAGAGTCAGGAAGG - Intronic
1104616941 12:130278513-130278535 GGGGATATGGATAAACAGCAGGG + Intergenic
1105916165 13:24918642-24918664 GTGGAAATGAATCATCATAAAGG + Intronic
1106935423 13:34713364-34713386 GTAGGTATGTATAATAAGGACGG + Intergenic
1107197631 13:37672519-37672541 GTGGATAGGAATCATAAGGAGGG - Intronic
1107346638 13:39468628-39468650 GGGGATATGAATAATCCTGATGG - Intronic
1108050706 13:46435214-46435236 GTGGATATGAAGAATCAGGTAGG - Intronic
1109160084 13:58961342-58961364 TAGGATATTAATACTCAGGAAGG - Intergenic
1109543282 13:63808838-63808860 GTGGATATGAAGAATCAGGTAGG - Intergenic
1111208113 13:85039297-85039319 GGAGCTATGAATATTCAGGAAGG + Intergenic
1113508947 13:110836557-110836579 GGGGTTATGAATATTCATGAAGG + Intergenic
1115788716 14:36855662-36855684 GTGTATCAGAATAACCAGGAGGG - Intronic
1116614304 14:47114307-47114329 ATGGATATGAAGAATCAATATGG + Intronic
1116687037 14:48052884-48052906 GAGGCTATGAATATTCATGAAGG + Intergenic
1118297909 14:64587318-64587340 GTGAAGATGAGGAATCAGGAGGG + Exonic
1118911248 14:70063822-70063844 GTGGATATGAGTTTTCAGAAAGG - Intronic
1119490593 14:75029228-75029250 GTGGAAATGAATCATCATAAAGG + Intronic
1119895932 14:78220099-78220121 GTGGATGAGAATACTAAGGAAGG + Intergenic
1124462544 15:29906073-29906095 GTGGATATTAATAGTGAGGGAGG + Intronic
1128647097 15:69385715-69385737 GTGTATATGAAGAAAGAGGATGG - Intronic
1129675011 15:77627817-77627839 ATGGATATGAGCAATCAGGGAGG - Intronic
1130609374 15:85347028-85347050 TTGGATGTGAAAAGTCAGGAGGG - Intergenic
1133994226 16:10735731-10735753 GTGAATATGCATAATCACTATGG + Intergenic
1135383175 16:22010262-22010284 AAAGATATGAAGAATCAGGATGG + Intronic
1137607045 16:49793807-49793829 GTGGATGTGAATACACAGGGAGG + Intronic
1138924829 16:61578918-61578940 GGGGATATGATTATTAAGGATGG - Intergenic
1139642069 16:68298926-68298948 GTGGAGAAGAATGGTCAGGAAGG - Exonic
1139811733 16:69624605-69624627 GTGGATAGGGATAAGGAGGAAGG - Intronic
1144554176 17:16267264-16267286 GTGGAAATGGATCATCATGAAGG + Intronic
1149982607 17:61323274-61323296 GAGGAGAAGAATAATCAGAACGG - Intronic
1153231424 18:2940372-2940394 GTAGATCTGTATAATCAGCATGG - Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1155393012 18:25356068-25356090 GTGGTTATGAGTATGCAGGATGG - Intergenic
1156856415 18:41786849-41786871 TTGGATATGAATTATTGGGAGGG + Intergenic
1157350237 18:46877605-46877627 TTGAATATGAATAATTAGGTAGG - Intronic
1158193716 18:54860514-54860536 GTGGGCAGAAATAATCAGGAGGG - Intronic
1158301262 18:56055915-56055937 GTGGAAATGGATCATCATGAAGG + Intergenic
1158346850 18:56524598-56524620 GTGGATAGGAATGAGCAGGTGGG - Intergenic
1158531256 18:58264029-58264051 GTGGAAAAGCATAATCAGTAAGG - Intronic
1158875138 18:61726418-61726440 GTGGAAATGAATCATCATAAAGG + Intergenic
1159318662 18:66816020-66816042 GTGGAAATAGATAAGCAGGAAGG + Intergenic
1159593565 18:70360900-70360922 GAAGATATGAATATTCATGAAGG + Intergenic
1161498330 19:4599096-4599118 GTGGATATGAGTTTTCAGGCAGG + Intergenic
1164799705 19:31066616-31066638 GTGCACATGATTCATCAGGAAGG - Intergenic
1165615541 19:37196675-37196697 GTGGAAGTGAATCATCATGAAGG - Intronic
1166584788 19:43936083-43936105 GTGTCTATGAATATTCAGTAAGG + Intergenic
1167332321 19:48863907-48863929 GTGCATAAGAATCACCAGGAAGG + Intronic
929267843 2:39939045-39939067 GTGCATAAGAATCATCTGGAGGG + Intergenic
930741771 2:54838908-54838930 GTGGTTTTAAATAATGAGGATGG + Intronic
933099435 2:78233454-78233476 GTGGAAGTGAATCATCAGAAAGG - Intergenic
935946828 2:108294252-108294274 GTGGATATGATTGAACAGAATGG + Exonic
935998199 2:108797141-108797163 GTGGATATAATTAAGCAGAAAGG + Intronic
937075748 2:119105143-119105165 GTGGAGAAGAACAATCAGGAGGG - Intergenic
945523218 2:210855085-210855107 ATGGATAGGAAGAATCAGTATGG - Intergenic
946052465 2:216875266-216875288 TTGGATACCAAAAATCAGGACGG - Intergenic
1169189570 20:3649564-3649586 GTGCACATGAAAAATCAGGCAGG + Exonic
1170573445 20:17645916-17645938 GTGGGTATGAAATACCAGGAAGG + Intronic
1172697818 20:36834529-36834551 GTGGATAAAAATCACCAGGAGGG - Intronic
1175634760 20:60571267-60571289 GTGGATATTAATATTCAAAATGG - Intergenic
1176661941 21:9645095-9645117 GAGGATGTGAGTAATCAGAAAGG + Intergenic
1178007368 21:28236857-28236879 ATAGATATAGATAATCAGGATGG + Intergenic
1182720701 22:32396596-32396618 ATGGATTTGATTAATCATGAAGG - Intronic
1184361486 22:44021696-44021718 GTGAAGATGAATCACCAGGATGG + Intronic
949335347 3:2968766-2968788 GTGGACAGTTATAATCAGGATGG + Intronic
949411248 3:3766807-3766829 GTGAAGATGGATAATCAGGCAGG + Intronic
949885959 3:8694250-8694272 GGGGATATGAATAATAACCAGGG + Intronic
950490824 3:13303935-13303957 GAGGATAGGGATGATCAGGATGG - Intergenic
953725664 3:45395733-45395755 GTGGTTATGAAAAATGAGTAAGG + Intronic
954092922 3:48299931-48299953 GTGGATATGAAGAGTGAGGGAGG - Intronic
954834695 3:53455602-53455624 GTGGAGCTGCATAATGAGGATGG - Intergenic
955718063 3:61851828-61851850 GTGGAGGTGAAAAATCAGAAGGG + Intronic
956712446 3:72050367-72050389 GTGGTTATGAATATTCAAGGTGG + Intergenic
956829663 3:73033615-73033637 CTGGAAATGAATAATGATGATGG - Intronic
958917507 3:100066013-100066035 GTGCATTAGAATAATCTGGAAGG - Intronic
959795308 3:110420621-110420643 GTGGAAATGAATCATCATAAAGG - Intergenic
960759683 3:121059582-121059604 ATGGATAGGAAGAATCAGTATGG - Intronic
961931675 3:130540270-130540292 GAGGATATTGATAATCAGGGAGG - Intergenic
961959991 3:130844931-130844953 GTGCATATGAATTACCTGGAAGG - Intergenic
962176997 3:133165785-133165807 GGGGCTATGAATATTCATGAAGG + Intronic
966318791 3:178677853-178677875 GGAGCTATGAATATTCAGGAAGG + Intronic
966515579 3:180817283-180817305 TTAGATATGAAGAATAAGGAAGG + Intronic
966971227 3:185047302-185047324 GTGGCTATGAAGATTCAAGAAGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967680138 3:192352334-192352356 GTGCATCAGAATAATCTGGATGG + Intronic
973108564 4:46372067-46372089 GTGCATATGAATAACCTGGTTGG - Intronic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
974258895 4:59498740-59498762 GGGGATGTGAATAATCAGGAAGG + Intergenic
974623173 4:64386330-64386352 GTGGAAATGGATAATCATGAAGG + Intronic
974799198 4:66793749-66793771 GTGGATGTGAGTATTCAGGAAGG - Intergenic
975450551 4:74520235-74520257 GAGGATTTTAATAATTAGGATGG - Intergenic
979156944 4:117406145-117406167 GTGGAGAAGAAAAATCAAGATGG + Intergenic
981509854 4:145544166-145544188 GGGGATATTAATAATGAGGGAGG + Intronic
982928754 4:161375042-161375064 ATGGAAATGAATAAGCAGCACGG + Intergenic
983046048 4:162987221-162987243 GAGGAGTTGAATAATCAGGCTGG + Intergenic
986316800 5:6594685-6594707 GGAGCTATGAATATTCAGGATGG - Intergenic
986896744 5:12380331-12380353 ATGGATAGGAATAATCAATAAGG - Intergenic
988161370 5:27521981-27522003 GTAGATATGAAAAAACAGTATGG - Intergenic
988628885 5:32907758-32907780 GAGGATATGGAGAAACAGGAAGG - Intergenic
989020686 5:37003297-37003319 TTGGAGAAGAATATTCAGGATGG + Exonic
989286346 5:39704381-39704403 GTCCACAAGAATAATCAGGAAGG + Intergenic
990398290 5:55407689-55407711 GAGGCAACGAATAATCAGGAGGG - Intronic
991008588 5:61857390-61857412 GTGCATCAGAATCATCAGGAAGG - Intergenic
993547814 5:89234053-89234075 GTCAATGTGAATAATCATGAAGG - Intergenic
993834410 5:92799059-92799081 GTGGACTGGAATAATCAAGAAGG + Intergenic
995069172 5:107898430-107898452 GTGGAAATGAATCATCATAAAGG - Intronic
995070896 5:107920519-107920541 GTAGACATGAATTATCAGAAGGG + Intronic
995214488 5:109580030-109580052 CTGAATATGACTTATCAGGAAGG - Intergenic
996166737 5:120233020-120233042 GTGGATAGGAAGAATCAATAAGG - Intergenic
997251662 5:132393365-132393387 GTAAATAAGAATAATCAGCATGG + Intronic
997278528 5:132620902-132620924 GTGGAAATGAATCATCATAAAGG + Intronic
997351758 5:133236133-133236155 GTGGATGTGAAGGCTCAGGAAGG - Intronic
997718161 5:136057452-136057474 GTGGCTAAGAAAAATGAGGAAGG + Intronic
997814834 5:137006312-137006334 ATGGATAGGAAGAATCAGTATGG - Intronic
1003232498 6:4267388-4267410 GTGGAAATGAATCATCATGAAGG + Intergenic
1005682491 6:28220429-28220451 GGAGCTATGAATATTCAGGAAGG + Intergenic
1008147602 6:47910675-47910697 GTGGATACTAAGATTCAGGAGGG - Intronic
1009682470 6:66915357-66915379 TTGGATATGCAAAATCTGGAAGG + Intergenic
1010728164 6:79359183-79359205 GTGGATATGGATCATCATAAAGG + Intergenic
1011068627 6:83358079-83358101 GTGGAAAAGAATATTAAGGATGG + Intronic
1012242484 6:96889380-96889402 GTAGATATGAATAAAGAAGATGG + Exonic
1014041744 6:116835169-116835191 GTGGAAATGAATCATCATAAAGG - Intergenic
1015094822 6:129402623-129402645 GTGGATAGGCTTAATTAGGAGGG + Intronic
1015697277 6:135995039-135995061 GGGGACATGAAGAAGCAGGATGG - Intronic
1016306721 6:142692749-142692771 GTGCATATGAATAATCATCCTGG - Intergenic
1016661424 6:146585452-146585474 GTGAAAATGAATATTCATGAAGG - Intergenic
1016769044 6:147828264-147828286 CTCCATGTGAATAATCAGGAAGG + Intergenic
1017377106 6:153783953-153783975 TTGGATATGAATGATAAAGATGG - Intergenic
1017462047 6:154660375-154660397 TTGGATATTATTAATCATGAGGG + Intergenic
1018315249 6:162550278-162550300 GTGGAAGTGAATTATTAGGAAGG + Intronic
1018637820 6:165879908-165879930 GTGGATATGAATTCTCGGGGGGG + Intronic
1020513255 7:9085897-9085919 GGGGATATTAATAATAAGGAAGG + Intergenic
1021633674 7:22670386-22670408 GTGCTTATGAATAATCATGAAGG + Intergenic
1022543287 7:31159949-31159971 GTGGAAATGAAAAATAATGAGGG - Intergenic
1023230631 7:38024272-38024294 CTGGAGATGAGTAAGCAGGAGGG + Intronic
1024488560 7:49948786-49948808 GTGGCTATGGAAAATCAGTATGG + Intronic
1028265355 7:88717182-88717204 GTGTATATGTACAATCATGATGG + Intergenic
1028663826 7:93317013-93317035 GTGGATATGGATACACTGGAAGG + Intronic
1028715998 7:93969495-93969517 GTGGATATGAATAATCAGGAAGG + Intronic
1031730133 7:125289848-125289870 GTTGATATGAATTTTCTGGAAGG - Intergenic
1031812587 7:126391015-126391037 GTGGTTTAAAATAATCAGGAAGG - Intergenic
1033718350 7:144027020-144027042 GCAGAGATGAATAATCAGGATGG - Intergenic
1034291817 7:149938603-149938625 ATGGAATTGAATAATCTGGATGG - Intergenic
1037439333 8:18898755-18898777 GTGGAAATGAATCATCATAAAGG + Intronic
1038680677 8:29664236-29664258 CTGGATACGAAGACTCAGGATGG - Intergenic
1039765173 8:40620921-40620943 TTGGAAATGAATAAGCAGTAGGG - Intronic
1041428445 8:57750116-57750138 GTGTAAATAAATAATGAGGAAGG + Intergenic
1041571788 8:59345266-59345288 GGGCATATGAATAATCAAGATGG + Intergenic
1041846039 8:62330205-62330227 GGGGTGATGAATAATGAGGATGG + Intronic
1042404102 8:68383715-68383737 GTCAAAATAAATAATCAGGATGG - Intronic
1042566953 8:70121315-70121337 ATGGATATGATTAAGCAGGAGGG - Exonic
1042660709 8:71151410-71151432 GTTGATATCAATAATTAGGGAGG - Intergenic
1043398605 8:79862001-79862023 ATGGATAGGAATAATCAATATGG - Intergenic
1043555201 8:81422130-81422152 GCGGATATAAATCAGCAGGAAGG + Intergenic
1044208219 8:89517373-89517395 GTGGAAGTGAATAATCATAAAGG - Intergenic
1045816479 8:106282665-106282687 GTGGAAGTGAATAATCATAAAGG + Intronic
1046033979 8:108819228-108819250 GAGGATGTGAAGGATCAGGAAGG - Intergenic
1046874864 8:119242940-119242962 GTGGAAATGAATTATCAGGTTGG - Intronic
1048577368 8:135703718-135703740 GTGGCTATGAATTCTCAGGGAGG + Intergenic
1048651562 8:136484205-136484227 GTGGAAATGAATCATCATAAAGG + Intergenic
1051222423 9:14863716-14863738 GTGGATATGTATTGTCATGAGGG - Intronic
1051306226 9:15712943-15712965 AAGGATCTTAATAATCAGGAGGG - Intronic
1051912520 9:22170685-22170707 GTGCCTATGACTAATTAGGATGG - Intergenic
1056911235 9:90702736-90702758 GGAGATATGAATATTCATGAAGG + Intergenic
1056942306 9:90966035-90966057 TTGCATATGGAAAATCAGGAAGG + Intergenic
1057097770 9:92327461-92327483 GGGGCTATGAATATTCACGAAGG + Intronic
1058789593 9:108429322-108429344 GTGGCTCTGCACAATCAGGAAGG + Intergenic
1058961738 9:109998413-109998435 GAGGACGAGAATAATCAGGATGG + Intronic
1059067192 9:111097917-111097939 GGGGATTTTAATAATCAGGGAGG - Intergenic
1060436344 9:123596170-123596192 GGGGATAGGAGTAGTCAGGAGGG - Intronic
1203639502 Un_KI270750v1:146938-146960 GAGGATGTGAGTAATCAGAAAGG + Intergenic
1185826099 X:3251403-3251425 GTGGCTATAAATAATCAAAATGG - Intergenic
1186305582 X:8253460-8253482 GTGAATATTAATATTCATGAAGG - Intergenic
1186927547 X:14351889-14351911 GTGGAAATGCAGAAGCAGGAGGG + Intergenic
1187537320 X:20154169-20154191 GTGGCTATAAATTATCATGAGGG + Exonic
1188909603 X:35830300-35830322 ATGGAGATGAACAATCTGGATGG - Intergenic
1188995757 X:36883216-36883238 TTGGATATGGATAATCCTGAGGG + Intergenic
1189681941 X:43526139-43526161 ATAGATATGAATATTCATGAAGG + Intergenic
1190617660 X:52252808-52252830 GCGGATATTAATAGTCAGGGAGG - Intergenic
1191186461 X:57618258-57618280 GTGGATAGGAATAATCAATATGG + Intergenic
1192228823 X:69249583-69249605 ATGGATAGGAAGAATCAGTATGG + Intergenic
1192679446 X:73236601-73236623 GTATCTATGAATATTCAGGAAGG - Intergenic
1193570452 X:83135350-83135372 GTGGAAATGAATCATCACAAAGG + Intergenic
1195120263 X:101742823-101742845 GTAGACATGTATAATCTGGAAGG + Intergenic
1196095960 X:111800250-111800272 GTGGAAGTGAATCATCATGAAGG - Intronic
1196305059 X:114092238-114092260 GTGGATATGAAGAATCAATATGG + Intergenic
1196594640 X:117530002-117530024 GAGGATATGAATTGTAAGGAGGG - Intergenic
1198191346 X:134309926-134309948 ATGGATAGGAAGAATCAGTATGG + Intergenic
1198447411 X:136731159-136731181 GAGAATATGAAAAATCAAGAAGG - Intronic
1199559117 X:149144349-149144371 GAGGATATCAATAATAGGGAAGG - Intergenic
1202018669 Y:20440361-20440383 GTGGATATTAATAAAAAGTAAGG + Intergenic
1202380508 Y:24273163-24273185 TTGGATGTGAAAAGTCAGGAGGG - Intergenic
1202490276 Y:25396962-25396984 TTGGATGTGAAAAGTCAGGAGGG + Intergenic