ID: 1028717243

View in Genome Browser
Species Human (GRCh38)
Location 7:93985196-93985218
Sequence TCATAATCTACCTTGAGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028717237_1028717243 29 Left 1028717237 7:93985144-93985166 CCAACTCCAGAAAGTTAGAAATA 0: 1
1: 0
2: 3
3: 102
4: 1003
Right 1028717243 7:93985196-93985218 TCATAATCTACCTTGAGTCTGGG No data
1028717236_1028717243 30 Left 1028717236 7:93985143-93985165 CCCAACTCCAGAAAGTTAGAAAT 0: 1
1: 0
2: 0
3: 41
4: 385
Right 1028717243 7:93985196-93985218 TCATAATCTACCTTGAGTCTGGG No data
1028717239_1028717243 23 Left 1028717239 7:93985150-93985172 CCAGAAAGTTAGAAATATGGCTA 0: 1
1: 0
2: 0
3: 19
4: 217
Right 1028717243 7:93985196-93985218 TCATAATCTACCTTGAGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028717243 Original CRISPR TCATAATCTACCTTGAGTCT GGG Intronic
No off target data available for this crispr