ID: 1028719222

View in Genome Browser
Species Human (GRCh38)
Location 7:94010632-94010654
Sequence CAGGGTAAATATTCTGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028719222_1028719227 15 Left 1028719222 7:94010632-94010654 CCACCCACAGAATATTTACCCTG No data
Right 1028719227 7:94010670-94010692 AAAAAAAAAAAAAAACGAGTTGG No data
1028719222_1028719228 16 Left 1028719222 7:94010632-94010654 CCACCCACAGAATATTTACCCTG No data
Right 1028719228 7:94010671-94010693 AAAAAAAAAAAAAACGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028719222 Original CRISPR CAGGGTAAATATTCTGTGGG TGG (reversed) Intergenic
No off target data available for this crispr