ID: 1028720804

View in Genome Browser
Species Human (GRCh38)
Location 7:94028651-94028673
Sequence ACCTGGGAGCTACTAAATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028720800_1028720804 -6 Left 1028720800 7:94028634-94028656 CCAACAGCATTAGTATCACCTGG No data
Right 1028720804 7:94028651-94028673 ACCTGGGAGCTACTAAATTAGGG No data
1028720797_1028720804 1 Left 1028720797 7:94028627-94028649 CCCCTGACCAACAGCATTAGTAT No data
Right 1028720804 7:94028651-94028673 ACCTGGGAGCTACTAAATTAGGG No data
1028720795_1028720804 29 Left 1028720795 7:94028599-94028621 CCTAGGTCATTAATTCTCAGAGA No data
Right 1028720804 7:94028651-94028673 ACCTGGGAGCTACTAAATTAGGG No data
1028720798_1028720804 0 Left 1028720798 7:94028628-94028650 CCCTGACCAACAGCATTAGTATC No data
Right 1028720804 7:94028651-94028673 ACCTGGGAGCTACTAAATTAGGG No data
1028720796_1028720804 2 Left 1028720796 7:94028626-94028648 CCCCCTGACCAACAGCATTAGTA No data
Right 1028720804 7:94028651-94028673 ACCTGGGAGCTACTAAATTAGGG No data
1028720799_1028720804 -1 Left 1028720799 7:94028629-94028651 CCTGACCAACAGCATTAGTATCA No data
Right 1028720804 7:94028651-94028673 ACCTGGGAGCTACTAAATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028720804 Original CRISPR ACCTGGGAGCTACTAAATTA GGG Intergenic
No off target data available for this crispr