ID: 1028725355

View in Genome Browser
Species Human (GRCh38)
Location 7:94080847-94080869
Sequence GTTCCTTCCATTCCCAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028725355_1028725359 27 Left 1028725355 7:94080847-94080869 CCAGTTCTGGGAATGGAAGGAAC No data
Right 1028725359 7:94080897-94080919 GAGAACACCAATTCCATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028725355 Original CRISPR GTTCCTTCCATTCCCAGAAC TGG (reversed) Intergenic
No off target data available for this crispr