ID: 1028726203

View in Genome Browser
Species Human (GRCh38)
Location 7:94090658-94090680
Sequence GGGAAATGGCCTGCCTGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028726203_1028726212 5 Left 1028726203 7:94090658-94090680 CCCTTTCAGGCAGGCCATTTCCC No data
Right 1028726212 7:94090686-94090708 ATAGCGCACTTGGTGTAAAGGGG No data
1028726203_1028726207 -5 Left 1028726203 7:94090658-94090680 CCCTTTCAGGCAGGCCATTTCCC No data
Right 1028726207 7:94090676-94090698 TTCCCTCAGGATAGCGCACTTGG No data
1028726203_1028726211 4 Left 1028726203 7:94090658-94090680 CCCTTTCAGGCAGGCCATTTCCC No data
Right 1028726211 7:94090685-94090707 GATAGCGCACTTGGTGTAAAGGG No data
1028726203_1028726210 3 Left 1028726203 7:94090658-94090680 CCCTTTCAGGCAGGCCATTTCCC No data
Right 1028726210 7:94090684-94090706 GGATAGCGCACTTGGTGTAAAGG No data
1028726203_1028726213 10 Left 1028726203 7:94090658-94090680 CCCTTTCAGGCAGGCCATTTCCC No data
Right 1028726213 7:94090691-94090713 GCACTTGGTGTAAAGGGGTCTGG No data
1028726203_1028726214 14 Left 1028726203 7:94090658-94090680 CCCTTTCAGGCAGGCCATTTCCC No data
Right 1028726214 7:94090695-94090717 TTGGTGTAAAGGGGTCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028726203 Original CRISPR GGGAAATGGCCTGCCTGAAA GGG (reversed) Intergenic
No off target data available for this crispr